User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 11 of 11

Thread: TC mutation or cultural issue?

  1. #9
    Carnivorous plant enthusiast vraev's Avatar
    Join Date
    Aug 2006
    Location
    Ontario, Canada
    Posts
    2,806
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Its from BE.

  2. #10
    DETHCHEEZ's Avatar
    Join Date
    Feb 2010
    Posts
    410
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Trippy...

    I love it when weird things like that happen...
    Like when one of my Ventricosa made a round pitcher



    I wonder if, if you get viable seeds from it, if they would carry the trait or not
    It would be kind of cool in it's own way if it did

    Good luck with it

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A few years ago there was an article in CPN about another Nep that someone had that did this. It is just some freak thing.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 2 FirstFirst 12

Similar Threads

  1. Capturing a mutation....
    By Noddy in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 5
    Last Post: 08-23-2009, 02:56 PM
  2. D. adelae Mutation
    By MrFlyTrap2 in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 3
    Last Post: 01-30-2007, 09:20 PM
  3. A t/c mutation?
    By peter in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 14
    Last Post: 09-14-2004, 10:01 PM
  4. New VFT mutation?
    By Statik2426 in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 3
    Last Post: 04-22-2002, 05:00 AM
  5. Flytrap Mutation
    By RamPuppy in forum General Discussions
    Replies: 16
    Last Post: 04-06-2002, 04:59 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •