User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 21

Thread: N. merrilliana

  1. #1
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey all,

    Are you having difficulty with this species growing and or pitchering properly? Well I have discovered something quite interesting. Recently I asked Tony what he thought if my two plants should be repotted, he said they might need it but he wasn't 100% sure as the pots were big enough for the plants by the looks of it. So naturally my curiosity got the best of me so I unpotted one...lo and behold it was rootbound badly! So the moral of this stroy..check your Nepenthes roots if all else fails! This species really does require a very deep pot..not so much wide but DEEP.

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Cool

    I must concur. I have only limited experience with this plant, but it sure does grow better with lots of root room.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes schloaty, it is a very deep rooted plant...the root mass is very large but not in a wide fashion....more of a very long 'spike' shape penetrating deep down into the soil. I recently repotted them into nursury grade 1/2 gallon containers. They were orginally in 6 inch diameter, 5 inch deep pots. Now they were transplanted to 6 inch diameter, 9 inch deep pots. I am now sure I will get pitcher production once again. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Dustin,
    I was actually planning to cut off the top of a 2 liter soda bottle, and use that. The benefit here is that I'll be able to see the roots when they start getting cramped again! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have always believed in the concept of over potting my Neps. I believe it helps the roots but it also makes watering a heck of a lot easier. Although it does look a little silly when you have a plant 4" across in a pot twice as wide [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Schloaty, that'd be genius but make sure you drill plenty of large drain holes in it! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] N. merrilliana does not like it's roots cramped and moist...likes to spread them out in a very airy and loose mix fomr what I've learned.


    Pyro, definetly! But plants like N. lowii have hardly any root mass/system at all and can simply be sustained in a pot as long as the roots are covered, the pot is big enough to support the plant and that the soil stays moist enough. But the other guys like N. bicalcarata, N. truncata, N. sumatrana, and N. rajah need very large pots to get bigger...and not die. I need to repot my N. rajah soon! I am afraid to think how many roots are at the pot bottom! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Bical likes a big pot, too? Uh - oh. I have work to do tonight! Another two leaves, and I'll have to do the truncata too, AGAIN. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. bicalcarata needs quite abit of root space! But remember, plant size doesn't matter....root mass DOES! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] Just think of N. lowii...large plant little roots or an ephipyte! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

Page 1 of 3 123 LastLast

Similar Threads

  1. anyone have a spare merrilliana?
    By phissionkorps in forum Carnivorous Plant Trading Post
    Replies: 6
    Last Post: 10-04-2007, 06:05 PM
  2. Nepenthes merrilliana x ?
    By fc3srx713b in forum Identify That Plant!
    Replies: 5
    Last Post: 09-07-2005, 02:24 AM
  3. Does my merrilliana need
    By superimposedhope in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 18
    Last Post: 06-09-2004, 01:28 PM
  4. Image of N. merrilliana
    By neps in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 12
    Last Post: 04-13-2004, 03:55 AM
  5. N.Merrilliana
    By nepenthes gracilis in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 12
    Last Post: 10-25-2001, 01:49 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •