User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: My mystery nep

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So I have a cutting of this Nep that I got off one of the profs here, he didn't know what it was but it is nice so I said sure. I got the cutting rooted and put it outside with my other Neps. In less than a weeks time it has gone totally orange-red. I seem to recall that northiana has this trait when under anything but low light. Am I recalling corectly or am I nuts?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Well Pyro,
    You are nuts, but that has nothing to do with your recolection! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Sorry, though, can't add any insight, just smart a$$ comments.....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. sanguinea can be orange-red too(some clones), as well as N. bicalcarata or ventricosa. Can you give us a pic? Best likely scenariao is probably a hybrid.

    Regards,

    Joe

  4. #4
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. khasiana has reddish-orange leafes under good lighting conditions...at least mine in the greenhouse does.

  5. #5

    Join Date
    Dec 2002
    Location
    Michigan Zone 5 (near Flint)
    Posts
    617
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a N. maxima with red/orange upper leaves.

    Glenn

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It isn't khasiana or ventricosa (I own both of those plants and know how they look) and bical is out because of the pitchers.

    When I saw the plant I thought maxima but the leaves are wrong.

    I was thinking hybrid too, might northiana be a parent and pass the turn red trait on?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a sanguinea next to an xRokko, and the sanguinea is green but the xRokko is so orange is't freeking me out.

  8. #8
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmm...hopefully it's not orangy reddish leaves from death occuring.

Similar Threads

  1. Still a Mystery...
    By tendrillbill in forum Identify That Plant!
    Replies: 1
    Last Post: 08-05-2008, 01:04 PM
  2. Mystery egg
    By maneatingmoo in forum General Discussions
    Replies: 11
    Last Post: 06-29-2008, 03:02 PM
  3. mystery bug
    By Nepenthe in forum Butterwort (Pinguicula)
    Replies: 5
    Last Post: 04-07-2004, 08:07 PM
  4. Mystery nep
    By carcinos in forum Identify That Plant!
    Replies: 3
    Last Post: 07-26-2003, 06:05 PM
  5. Mystery dew?
    By Darcie in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 4
    Last Post: 12-30-2002, 11:17 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •