User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: N hamata has hitchiker

  1. #1
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There are no sundews kept in my highland Nepenthes terrarium but today while I was doing watering I noticed a glint of red light in the carpet of living NZ sphagnum moss on the top of the N. hamata pot. I see that a tiny sundew about 2 cm across has appeared in it. Have any of you had this happen in your moss?
    It has big perfectly round leaf traps with very long tendrils and thin petioles it looks much different than my D. rotundafolia or D. spatulatas. Any ideas?

  2. #2
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah, a sundew popped upin my S.Alabamensis's pot and it growing but no idea what it is, looks like it is an Intermedia from what I can see now. But will just have to wait. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  3. #3
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yup, a couple D. burmanni popped up in my moss, along with blades of grass [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Heck, burmanni finds its way everywhere, found 10 or so of them growing in my red dragon pot. Some seeds must've spilled from the seed pod before I had a chance to cut it off
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  4. #4

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a whole lawn of that annoying grass popping up. how do you get rid of them?

    I do not have any binatas, and a couple of weeks ago, one popped up! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] free plants, I love it!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a wonderful mystery pygmy that appeared out of no where in my D. extrema pot.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Guest
    Yeah, I have a bunch of sundews popping up in my D. Extrema pots too (about ten). Some are red, and some are green. Same goes for the pot that I have my thorelii x (maxima x stenophylla) in. That makes about twenty. Soo many sundews [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] .

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    I love hitchhikers!

    I got a couple of what look like (so far) Capensises (although one is growing curiously tall) from my U. Livida pot, a few from my VFT's and one from one of my Sars. Gotta love it!

    Some even became gifts....

    I also got my only Binata this way (there were 3, but now there's only one), which is FLOURISHING.

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8

    Join Date
    Aug 2001
    Location
    San Francisco, CA
    Posts
    988
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yup, i love hitchhikers also, but some are annoying, like grass in my sphagnum moss.
    Taproot, Anti-Flag, The Casualties, Alkaline Trio, Eleventeen, Deadsy, AFI...what's not to love?

Page 1 of 2 12 LastLast

Similar Threads

  1. Hamata
    By Grey Moss in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 14
    Last Post: 06-17-2011, 09:10 PM
  2. Looking for N. hamata
    By theyellowdart in forum Carnivorous Plant Trading Post
    Replies: 1
    Last Post: 11-24-2008, 09:54 PM
  3. Looking for Hamata
    By elsantaclause in forum Carnivorous Plant Trading Post
    Replies: 1
    Last Post: 11-12-2008, 03:49 PM
  4. hitchiker!
    By theyellowdart in forum Utricularia, Aldrovanda, Genlisea
    Replies: 5
    Last Post: 04-09-2008, 02:14 PM
  5. N. hamata
    By TomV in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 3
    Last Post: 06-11-2003, 06:20 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •