User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: N. veitchii 'lowland'

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Does the lowland form of N. veitchii have any special requirements (ie soil, light?) or is it just basically your typical Nep from the lowlands?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    You've got mail [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Sep 2002
    Posts
    825
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro, no speical requirement treat it like a lowland, soil type i have mine in peat,l/f moss,orchid mix, keep some what humid. it is easy to grow and to propagate from cuttings
    George McKay

    In The End We are All Dead
    Florida

  4. #4

    Join Date
    Jul 2001
    Location
    somewhere in NJ
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    The leaves and pitchers are longer than the highland variety.

  5. #5
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmm anything special bout Veitchii lowland....nope not that I can think of! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] Yes good point Eplants pointed out the leaves and pitchers are longer than that of the highland variety. I also belive the pitchers of the lowlnad Veitchii are typically greenish-yellowish-orange colored. Highlands are more golden to rarely striped like a candy cane.

  6. #6

    Join Date
    Sep 2002
    Posts
    825
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    the lower pitchers are more of the greenish/yellow side if anything, the upper pitchers are greenish/yellow w/ red strips. the leaves get up to 23-25cm long
    George McKay

    In The End We are All Dead
    Florida

  7. #7

    Join Date
    Feb 2002
    Location
    z11 Puerto Rico
    Posts
    507
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Neps of borneo says that the plant is mostly found growing as an epiphyte, so maybe you should put it in a hanging basket. I guess that would be the only difference from other lowland neps. :/

    Jœl
    http://homepage.mac.com/mindmaze128/...lood forum.jpg
    Joel Martínez
    San Juan, Puerto Rico, USA

Similar Threads

  1. truncata x veitchii Batu Buli, veitchii x maxima xx veitchii
    By Zero in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 5
    Last Post: 02-14-2009, 09:00 PM
  2. Replies: 13
    Last Post: 07-06-2007, 03:34 PM
  3. Replies: 12
    Last Post: 07-03-2007, 04:37 PM
  4. veitchii lowland (Sungai Samba) flowering, looking for female from same location
    By Marcello Catalano in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 1
    Last Post: 05-15-2007, 01:32 PM
  5. Where I can get Nepenthes veitchii (lowland)?
    By eBeyonder in forum Foreign Carnivorous Plant Resources
    Replies: 0
    Last Post: 01-11-2006, 03:52 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •