User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: nepenthes anamensis

  1. #1
    BANNED
    Join Date
    Apr 2002
    Location
    Southern California
    Posts
    87
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Anybody got information and pictures of nepenthes anamensis .

  2. #2

    Join Date
    Aug 2001
    Location
    West Lafayette, Indiana
    Posts
    298
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There's been a lot of debate on anamensis for as long as I can remember. One of the very first nepenthes offered by Peter Pauls' was labelled anamensis, but I believe it eventually got re-identified as an alata. There is a variety offered by Malesiana labelled as N. alata var. anamensis, so they seem to be in the camp that shuffles the plant under the alata complex. Others stand firmly behind the notion that anamensis is a species unto itself. Not sure, though...this debate may have been settled recently. I haven't read anything new on it lately. Oz

  3. #3
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N.Anamensis is supposedly to be closely related to N.Khasiana. I belive this to be a good assumption. N.Anamensis has features similar to Khasiana and I personally think it is a sub form of Khasiana, or a natural mutation that Anamensis was orginally a Khasiana then mutated and turned to look slightly different. This is all IMO though. It has been recorded to be an easy grower, and handels well in cultivation. If you need more info on where to get this palnt, culitvation specs or anyhting message or E-Mail me. hope this helps. [img]http://www.**********.com/iBhtml/non-cgi/emoticons/smile.gif[/img]

  4. #4
    Guest
    I was getting ready to start a post requesting info on the species myself. What a coincidence! According to the book Carnivorous Plants of the World, by James and Patricia Pietropaolo, they easily grew the plant on their windowsill for years, and it pitchered well. It was the only nepenthes they linked with windowsill cultivation.

  5. #5
    BANNED
    Join Date
    Apr 2002
    Location
    Southern California
    Posts
    87
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    could some one tell me a specific place in vietnam where could i find it .

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    google.com search for "Nepenthes anamensis, range"
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    abhidharma
    Guest

    Thumbs up

    I just posted a few days ago to the CP Listserv about a hybrid I obtained, N. x margaretea. The CP Database had this hybrid's ancestry listed as anamensis x ventricosa, but the guy who sold it told me it was kampotiana x ventricosa. Someone on the Listserv confirmed that these two (anamensis and kampotiana) are now considered to be the same species. [img]http://www.**********.com/iBhtml/non-cgi/emoticons/biggrin.gif[/img]

  8. #8
    Guest
    N. anamensis is on Vietnam's Threatened Plant Species list. There's no need to field collect when you can obtain it from a reputatble source.

Page 1 of 2 12 LastLast

Similar Threads

  1. Anamensis revisited: snails?
    By dlybrand in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 3
    Last Post: 05-13-2008, 12:18 PM
  2. Anamensis problems
    By dlybrand in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 8
    Last Post: 05-10-2008, 09:06 AM
  3. N. geoffrayi and N. anamensis
    By tomkahl in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 2
    Last Post: 12-18-2006, 05:05 PM
  4. N.anamensis or N.kampotiana
    By TyFone in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 2
    Last Post: 01-17-2006, 09:13 AM
  5. N.anamensis
    By TyFone in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 5
    Last Post: 07-12-2005, 02:23 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •