User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: Which should I buy?

  1. #1
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    I am going to get a Nepenthes, but which one should I get: the rafflesana or the gracilis?? They are both cool but I don't know if i want a vine or not. Which one would you get? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wesley,

    Both of these will go to vine with time (as will all Neps.)

    For looks I'd go with the raff but for basic easy bomb-proof I'd go with gracilis
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks I was thinking of the raff though, maybe I will get the gracilis at some other point.
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Pyro,
    Bomb proof? You just mean that YOU haven't blown one up (literally), right? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]


    Sorry...couldn't resist....I just read your thread about crazy things we've done....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually I have never grown a gracilis but I am going off reports of other people. So 'No' I have not LITERALLY blown one up [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    I have however doused a different plant in kerosine and lit it on fire, then chopped up the what was left and threw it in my mulch bag and a month later I had 50 of the buggers [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] Now THAT was a true bomb proof plant
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What plant was that Pyro? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Wesly, I would go with either one. Gracilis will vine and become a pretty plant while Rafflesiana will be more of a low grower with a fabulous display of lower pitchers in a small rossette.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A Devil's Backbone. I use them in my desert terrariums now (because I can't get rid of them.) The thing is a hang on from my first try at CPs more than 10 years ago!!! NAturally all my CPs died but that thing hung on and is still hanging on. And that isn't the only abuse I have put it through, it has been frozen, ignored for a year, left in a closet for 3 months and (the worst fate for any plant) let with my mother.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If space is not a huge issue then go with the N. rafflesiana. It is much more dramatic! A small plant will stay short for a while and make a nice rosette. I think they are more tolerant to lower humidity and will still pitcher well also, so can be grown on a windowsill easier.
    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •