User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Windowsill nepenthes

  1. #1

    Join Date
    Jan 2003
    Posts
    22
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What would be considered some of the best "Windowsill Nepenthes?"
    ~Christine
    & Lucy the Giant Schnauzer
    http://www.geocities.com/lucythegiantschnauzer

    Growing:
    VFTs, Sarracenias, Nepenthes, Bladderworts, Pings and Sundews

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Where do you live? It really depends.....
    Please give a detailed description of the climate
    on your windowsill.
    Temperature rage (day and night)
    humidity
    sun (or other light source)
    Anything else you can think of. THEN we can recomend something. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. ventricosa does really well in windowsills. N. alata and maxima would probably work too. You might also be able to get N. truncata going (a couple members here have I think.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would agree with both posts. N. alata, N. ventricosa, N. truncata, N. xVentrata are very tolerant plants. BUT your individual growing conditions will greatly determine your success growing Nepenthes on a windowsill.

    For example, I live in the Northeast US where Spring, Summer, Fall are fairly humid (we do not have AC which would dry the air significantly). I had a N. truncata grow from a 3 inch plant to over 12 inches in diameter in a 2 year span sitting in my East window. In addition to N. xVentrata and N. khasiana and some others around the house. During the winter the plants did not pitcher so well when the cold dry air and the heat was on in the house. So your local climate as well as heat/cooling systems etc within your house will play a huge role in success and degree of success.
    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

  5. #5

    Join Date
    Dec 2002
    Location
    Ireland
    Posts
    45
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I live in Ireland and I have a Nepenthes that is N. X ventrata or N. ventricosa and its currently pitchering well even though its the middle of winter. The pitchers don't retain the fluid for very long though.

    Its generally low in humidity year long around here even though it rains a lot you never get that "sticky" feel that you get in places like NY and Florida. Probably any nepenthes you get that's not from a specilised nursery is worth a shot, they're generally tough hybrids or species.

    Andrew

  6. #6

    Join Date
    Jan 2003
    Posts
    22
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    < Please give a detailed description of the climate
    on your windowsill.>>

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] Oh I was just thinking in general terms...like it would be nice to just have a list of suggestions, start some discussion [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    ~Christine
    &amp; Lucy the Giant Schnauzer
    http://www.geocities.com/lucythegiantschnauzer

    Growing:
    VFTs, Sarracenias, Nepenthes, Bladderworts, Pings and Sundews

  7. #7

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have never got a Nepenthes to grow in that manner(I live In Nebraska, if it matters). I have not tried putting a humidifier right up to a plant, though.

    Regards,

    Joe

  8. #8

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Several of my Nep. grow on a windowsill. The temps are usually 60-75░F. (if anyones interested,the ░symbol is alt+0176, and the ║symbol is alt+0186░║) usually they get bright to full sun from 9:OO A.M. - 12:OO P.M., then I close the blinds halfway so at least half of the plant is in shade to bright light at one time (while the other half has full sun) it might sound kinda silly, but at least it keeps them from burning... [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] Also, the humidity is always at least about 60%, but at times it is 90%

    (this is off subject, but my terrarium has about 90% humidity)

Page 1 of 2 12 LastLast

Similar Threads

  1. Windowsill Nepenthes . . .
    By BigBella in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 14
    Last Post: 06-13-2011, 08:58 PM
  2. Windowsill
    By sborirak in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 9
    Last Post: 07-06-2007, 04:41 PM
  3. Nepenthes windowsill growers - assemble!
    By trashcan in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 28
    Last Post: 02-05-2007, 09:26 AM
  4. Windowsill Nepenthes
    By Capslock in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 29
    Last Post: 04-08-2004, 02:39 PM
  5. Nepenthes on my windowsill?
    By WildFire in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 15
    Last Post: 09-20-2003, 05:28 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •