User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: What is your largest nep?

  1. #1

    Join Date
    Aug 2002
    Posts
    887
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello,
    I was wondering what your largest nepenthes is currently? Mine is a N. Alata "Highland Red Striped" that has a 15 inch leafspan, and 6'' pitchers. Ill have a pic up tomorrow,
    Kevin
    Kevin Peterson
    Grosse Pointe, MI

  2. #2
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    iono what you meant by biggest plant but if you mean tallest then it would be my n. gracilis , about 1 foot tall but the pitchers are really small , if its the widest plant then it would be my n. ventricosa with the diameter of 6 inches , but if you mean largest pitchers then it would be my sanguinea with 2 1/2 pitchers . [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  3. #3

    Join Date
    Sep 2002
    Location
    Ogden, UT
    Posts
    423
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nepenthes home depot x lowes x gublers (var. growithlikeweed)

    3 or so feet across with 1 foot pitchers. Can't figure out the heritage to save my life, but the thing sure is pretty.
    Loves to be sun burnt, fertalized, soaked medium, and fed about a quarter cup of skin milk a month. Nothing hurts it, even the rat lost.(not sure if that's a rat story of a fish tale)

    Tallest plant- gracilis- I'm getting tired of cutting the one that is in my 20 gallon tall viv.(PDF tank). Every time I cut it 3 more new branches head for the top. I think i might replace it with my Khasiana. It seems to grow at the same steady slow pace whether it is in the lowland room, highland room, window sill, sock drawer, or under the bed. Kind of like a ventricosa on sedatives.

    joe
    Signature.

  4. #4
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My largest Nep is my N. bicalcarata 'red trap' which is 5 feet in diameter and has 8" pitchers. It's so big it simply folds it's leaves in half as I have no terrarium large enough for the poor beast! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My largest AND tallest is my x wrigleyana (sp?) that I got from Ludwig (thanks Ludwig&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]. 18" to 24" high (not exactly sure) and about the same width.

    Biggest pitchers belong to my truncata.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My largest plant is, N. Coccinea. 12 inch leaves and 3-4 inch pitchers. That is my biggest by far! The runner up would be N. Rafflesiana at 7-8 inches across and 1 inch pitchers!

    SF

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My ventricosa is 4 feet tall. My maxima 'Sulawesi' had the largest pitcher at 9" until some kid trashed it!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Andenes's Avatar
    Join Date
    Jan 2003
    Location
    Ponce, Puerto Rico
    Posts
    307
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    My Coccinea has a leaf span of two feet and it's a foot and a half tall. I guess the biggest pitchers belong to my ventrata which are 7 inch tall and a width of an inch and a half. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Gee Snowy Falcon your coccinea is really BIG! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] Congrats to all of you!
    Mom says: "Its stupid to collect plants that all look alike! Get a new hobie!"

Page 1 of 2 12 LastLast

Similar Threads

  1. Largest VFT trap contest!
    By Chomp in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 12
    Last Post: 10-14-2009, 12:02 PM
  2. What are the largest sundews
    By Spintix in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 10
    Last Post: 05-28-2009, 10:36 AM
  3. largest Nep pitcher.?
    By peanuts1gang in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 10
    Last Post: 12-15-2005, 08:57 PM
  4. New largest nepenthes
    By in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 12
    Last Post: 01-20-2003, 09:30 PM
  5. Worlds largest cephalotus
    By Spectabilis73 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 13
    Last Post: 11-02-2002, 03:01 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •