User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Smaller n. species for a terrarium?

  1. #1

    Join Date
    Feb 2003
    Posts
    19
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    What are some of the smallest Nepenthes species that would make great terrarium plants. i have a ten gallon tank.

    thnx,
    Jason

  2. #2
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A few species which will do well for a while in a 10 Gal will be N. ampullaria & N. gracilis and on the harder to find and expensive end would be N. campanulata. But these will all outgrow a ten gallon pretty quickly.

    There are highland plants which stay sort of small such as N. inermis and N. dubia (see recent post from Andreas), N. adnata & N. aristolochides but these require cool nights between 50-60*F, very high humidity , flowing air and bright lighting which is daunting when youre first starting out And all of it is a lot of work for a small tank with only two or three plants in it.

    A 55 or 75 gallon tank would be better and give you an opportunity of more plant species to choose from and more time to grow them before they must be pruned back.

  3. #3

    Join Date
    Feb 2003
    Posts
    19
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    thank you swords, i think that i'll use some smaller carnivorous plant of other species for my ten gallon tank then. i kind of figure that it would not work out already, but just wanted to be sure. Probably some Drosera, one or two butterworst, a Heliamphora, and maybe a Dionaea.

    thnx,
    Jason

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Jason,
    That's how I have mine set up....The smaller tanks (two 10 and a 20) have my drosera, pings, utric (just one terrestrial ),seedling sarrs and seedling VFT's. The neps are in my 75 gallon tank.
    Even in the 75 gallon tank, I've already had to prune my N. Gracillis, and it's only been 8 months! 'Cource now I have TWO of them after I rooted the cutting. Silver lining, I guess. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Jul 2001
    Location
    somewhere in NJ
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Deathtraps,
    Their was a post before that dealt with small Nepenthes. Well here it is: Small Nepenthes

  6. #6

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't think campanulata will outgrow a 10 gallon that easily. The link the above post provided will be more revealing, but another primo would be N. adnata.

    Regards,

    Joe

  7. #7

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    NNNNNNOOOOOO!!!!!!!!!!! Don't get gracilis!!!!! mine is already bumping the top of my 29 gallon tank!!! get ventrincosa, ampularia, small ones that don't climb, but scramble! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. ventricosa will most certainly climb if you let it, I have one that is 3' tall.

    Glabrata is supposed to be another good small Nep but it is a bit picky. I have a faizaliana that seems to be growing rather compact (but I have not had it for a full year yet so who knows what it will do this summer.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Similar Threads

  1. Smallest CP species for a terrarium?
    By rollinkansas in forum Greenhouses, Terrariums and Bog Gardens
    Replies: 14
    Last Post: 07-01-2009, 01:38 PM
  2. Smaller pots for cps
    By Hortman in forum General Discussions
    Replies: 3
    Last Post: 06-26-2005, 03:03 PM
  3. Smaller fan
    By Sszvein in forum Greenhouses, Terrariums and Bog Gardens
    Replies: 14
    Last Post: 11-02-2004, 11:45 AM
  4. smaller new leaves in my nep
    By agustinfranco in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 15
    Last Post: 12-27-2003, 04:19 PM
  5. Sundew getting smaller & smaller & smaller
    By Leo in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 09-17-2003, 09:27 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •