User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 9 FirstFirst 12345678 ... LastLast
Results 25 to 32 of 66

Thread: My 6 years old N.rajah

  1. #25

    Join Date
    Jul 2002
    Posts
    12
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello!
    My Terrarium is 1.1m long 40cm wide and 45cm high.
    I take pure milk.
    But you´re right, my heli also doesn´t like milk.

    bye,
    Axel Faix

  2. #26
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would like to know about the soil in the terrarium. What was used in it's construction? It looks like there is some reddish laterite soil at the bottom and it also appears as there is no drainage. how does the tank smell? Has the Rajah lived in this terrarium for most of it's existance? I ask because I love having naturalistic terrariums instead of potted ones but I recently had to destroy a beautiful terarrium I'd worked on for several months due to the rotting sulfur smell of the substrate. So I'm always interested to hear how others do it!

    Thanks!

  3. #27
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Axel, do you add milk in all the pitchers more than one time or just once when they open Also if you do fertilze each pitcher more than one time what is your fertilization routine/schedule? Thank You!!!!

  4. #28
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Talking

    Axel,
    Amazing, simply amazing.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    .
    .
    .
    .
    drooling [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #29

    Join Date
    Jul 2002
    Posts
    12
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi! I´m sorry that I answer so late but I had much to do.

    @ swords:
    My rajah had lived in the terrarium since I have it.(3-4 years).
    On the bottom of the terrarium is ca. 7 cm pure Seramis (quite similar to perlite).The rest of the soil is made out of perlite, seramis and peat. I don´t know the exact mixture ratio, sorry.
    My terrarium smells of peat(there´s no fragrance of rotting soil) . I exchange the soil every 2-3 years. (I exchanged soil a few weeks ago.)

    @ng: I only add milk in the pitchers then they just opened. Sometimes if a think that I added to less milk in one pitcher I add milk a second time.

    PS:sorry for my orthography mistakes.

    Bye,
    Axel Faix

  6. #30
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How much milk do you add? 2 teaspoons??

  7. #31
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think he said that it was just a few drop somewhere earlier in the thread.

    Not trying to de-rail the subject but what is that Nep growing above the tank?

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #32

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    I absolutely LOVE it!!!!!!!!!!!!!
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    :
    :
    :
    I wish I had a plant like that! Is the moss in the terrarium green or sphagnum?
    I am back..

Page 4 of 9 FirstFirst 12345678 ... LastLast

Similar Threads

  1. Years ago
    By Ozzy in forum General Discussions
    Replies: 10
    Last Post: 11-18-2007, 09:11 PM
  2. 3 years in the life of a Nepenthes rajah
    By Jeremiah Harris in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 58
    Last Post: 01-01-2006, 03:29 PM
  3. 100 years ago
    By lavenderdawn in forum General Discussions
    Replies: 7
    Last Post: 07-17-2004, 07:39 PM
  4. Years and years with no bug problems...
    By FlytrapGurl in forum General Discussions
    Replies: 15
    Last Post: 10-23-2003, 01:40 PM
  5. My 6 years old N.rajah
    By Axel Faix in forum Foreign Carnivorous Plant Resources
    Replies: 3
    Last Post: 07-20-2002, 08:56 AM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •