User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 7 FirstFirst 1234567 LastLast
Results 17 to 24 of 51

Thread: Bragging competition......

  1. #17

    Join Date
    Dec 2002
    Location
    Michigan Zone 5 (near Flint)
    Posts
    617
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    My Nepenthes has been eating my cats!!!!!!

    Glenn

  2. #18
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a 3' ventricosa with a 1' flower spike and 2 large basal rosettes

    I have a N. khasiana with 5 basal rosettes

    I have a lowland vietchii that has no roots but has been growing strong and producing leaves for the last 7 months

    I was growing all my Neps indoors at 30% humidity with no ill effects and now they go out on the patio to take Atlanta weather with not protection of any kind.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #19
    Andenes's Avatar
    Join Date
    Jan 2003
    Location
    Ponce, Puerto Rico
    Posts
    307
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Question

    Everytime my raff is going to spout another pitcher it always grows double the size of the last one every week!
    My ventrata is also a speedy grower!
    And the pitcher on my truncata finally opened! I guess thats something to celebrate about
    And last ,but not least, my ventricosa is growing real fast...but it isn't producing any pitchers at all


    [QUOTE]LET'S KEEP ON BRAGGING!!!!
    Mom says: "Its stupid to collect plants that all look alike! Get a new hobie!"

  4. #20
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    I was growing all my Neps indoors at 30% humidity with no ill effects and now they go out on the patio to take Atlanta weather with not protection of any kind.
    [/QUOTE]
    30% ?? ?? ??
    And they pitchered? Wow.

    Anyway, my N. Truncata has grown two pitchers since I got it. The second one was at least 2 and 1/2 times bigger than the first one. There is a new leaf that just popped out and it looks to be at least twice the size of the last leaf.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The only one that seemed to not like the low humidity was the ventricosa. Its pitchers reduced in size. Everyone else pitchered fine.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,
    Well that stinks! That is the only kind of pitcher plant (ventricosa) I have ...
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  7. #23

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (carnivorous23 @ Mar. 17 2003,7:11)
    Tim, it is good to hear D. scorpiodes can stop alien invasions. To think, all the time I've wasted attempting to fend them off with some capensis and a filiformis.[/QUOTE]
    *falls out of chair*

    HAAAH!

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Down to 4" from 6" isn't a huge drop and they always rebound when they get outside for the summer.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  9. Page 3 of 7 FirstFirst 1234567 LastLast

    Similar Threads

    1. My CP's have some competition
      By disco in forum General Discussions
      Replies: 14
      Last Post: 03-25-2007, 10:37 AM
    2. Bragging rights
      By Sarraceniaobsessed in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 22
      Last Post: 04-20-2004, 07:44 PM
    3. Competition
      By Tim in forum General Discussions
      Replies: 1
      Last Post: 03-02-2003, 04:18 PM
    4. I just feel like bragging
      By Pyro in forum Butterwort (Pinguicula)
      Replies: 7
      Last Post: 12-23-2002, 02:12 PM

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •