User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 7 FirstFirst 1234567 LastLast
Results 17 to 24 of 51

Thread: Bragging competition......

  1. #17

    Join Date
    Dec 2002
    Location
    Michigan Zone 5 (near Flint)
    Posts
    617
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    My Nepenthes has been eating my cats!!!!!!

    Glenn [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  2. #18
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a 3' ventricosa with a 1' flower spike and 2 large basal rosettes

    I have a N. khasiana with 5 basal rosettes

    I have a lowland vietchii that has no roots but has been growing strong and producing leaves for the last 7 months

    I was growing all my Neps indoors at 30% humidity with no ill effects and now they go out on the patio to take Atlanta weather with not protection of any kind.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #19
    Andenes's Avatar
    Join Date
    Jan 2003
    Location
    Ponce, Puerto Rico
    Posts
    307
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Question

    Everytime my raff is going to spout another pitcher it always grows double the size of the last one every week! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    My ventrata is also a speedy grower! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    And the pitcher on my truncata finally opened! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] I guess thats something to celebrate about [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    And last ,but not least, my ventricosa is growing real fast...but it isn't producing any pitchers at all [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]


    [QUOTE]LET'S KEEP ON BRAGGING!!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Mom says: "Its stupid to collect plants that all look alike! Get a new hobie!"

  4. #20
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    I was growing all my Neps indoors at 30% humidity with no ill effects and now they go out on the patio to take Atlanta weather with not protection of any kind.
    [/QUOTE]
    30% ?? ?? ??
    And they pitchered? Wow.

    Anyway, my N. Truncata has grown two pitchers since I got it. The second one was at least 2 and 1/2 times bigger than the first one. There is a new leaf that just popped out and it looks to be at least twice the size of the last leaf. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The only one that seemed to not like the low humidity was the ventricosa. Its pitchers reduced in size. Everyone else pitchered fine.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,
    Well that stinks! That is the only kind of pitcher plant (ventricosa) I have [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] ...
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  7. #23

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (carnivorous23 @ Mar. 17 2003,7:11)
    Tim, it is good to hear D. scorpiodes can stop alien invasions. To think, all the time I've wasted attempting to fend them off with some capensis and a filiformis.[/QUOTE]
    *falls out of chair*

    HAAAH!

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Down to 4" from 6" isn't a huge drop and they always rebound when they get outside for the summer.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  9. Page 3 of 7 FirstFirst 1234567 LastLast

    Similar Threads

    1. My CP's have some competition
      By disco in forum General Discussions
      Replies: 14
      Last Post: 03-25-2007, 10:37 AM
    2. Bragging rights
      By Sarraceniaobsessed in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 22
      Last Post: 04-20-2004, 07:44 PM
    3. Competition
      By Tim in forum General Discussions
      Replies: 1
      Last Post: 03-02-2003, 04:18 PM
    4. I just feel like bragging
      By Pyro in forum Butterwort (Pinguicula)
      Replies: 7
      Last Post: 12-23-2002, 02:12 PM

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •