User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: N. jacquelineae

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi everyone,
    I was just discussing this species with Jeremiah via PM's. Since this is so new in cultivation, I figured I ask anyone who's growing it to share their experience. Now, Jeremiah has been growing it a fair bit longer than I have (and hopefully will post his set up/conditions here), but here I go (I think I've had it a month...give or take a week).
    I keep mine in a typical highland set up. 6-7 inches below 6 4' fluorescent tubes. The bud that was on it upon arrival has openned into a cute 1/4" (or so) pitcher. I'd say it had a 3" diamter upon arrival, and now is about 3.5 to 4"
    Night temps: 57-63 (or so)
    day temps: high 80's
    photo period: 16 hours
    humidity: Way up. Not sure exactly, but most likely around 85%.
    Soil: Not entirely sure....still in what it was shipped to me in. 3" pot. I'd guess a mix of pete/LFS and orchid mix. At least that's what it looks like....and fairly petey.
    I have gotten one new leaf with a swelling bud, and the next leaf is coming. So far, my set up seems to be working fairly well. I need some more experience so I can establish a cultivation benchmark.
    Cheers!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Hello,
    I have had this guy since November 18. I'd say it was about 2-3 inches diameter when I got it. Now probably 4-5". The pitchers and leaves get bigger with every new one, and the pitchers are getting really intensely colored! I mean REALLY red. Especially the peristome. I will have pictures in a photo gallery soon... It seems to grow pretty quickly for a highland nep, and the leaves and pitchers are long-lasting. My conditions are very similar if not near identical, with extreme light! That seems to be key for the rich red coloration in the peristome. Sorry this isn't the most detail possible, I just don't want to say to much to soon about this relatively new plant itno cultivation... I will say however, that mine is the original 1850 meter seed collection. Very nice and very beautiful!!
    I am back..

  3. #3

    Join Date
    Nov 2003
    Location
    S.California
    Posts
    339
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lithopsman sounds nice i cant wait to get my N. jacquelineae i also have very good lighting in my Highland set up Grow Lux lights seem to give off that beautiful rich red color. best wishes to you both!

    E/c
    http://Geocities.com/southerntropicals

    http://www.geocities.com/southerntro...rewstsmall.jpg
    Welcome to S O U T H E R N T R O P I C A L S the nepenthes and heliamphora garden.

  4. #4

    Join Date
    Mar 2004
    Location
    I'm from Mississippi but I go to college In New Orleans
    Posts
    467
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow!! cool i just posted about one of those plants tehehe. where did you get your plant from?
    I love Vin Diesel!! *Growl* Nobody better talk bad about him or else!!!

    Squirdword-\"Why do today what you can put off 'till tomorrow.\"
    Mr. Krabs-\"What is today but yesterday's tomorrow.\"
    *~*Spongebob Squarepants*~*

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I too have only had mine a short time but it is dooing well. That said however I really do not advocate growing like I do. My plant was in my sunroom until this past weekend. Temps ranged from 33F upto 80F, humidity from too low to measure up to too high to measure but mostly hung about 35-60%. The media is pure fine grade orchid bark topped with live sphag. Lighting was by my 400W HID/MH and whatever the sun happened to offer each day. I would mist daily and every week dump about 100-300ml of water through the pot. With the onset of spring I have moved the plant into my crawlspace. Lighting here is by 4 4' tubes. The temp never gets higher than 70 and drops to 50 at night. Humidity is higher and I have tossed a dome over the tray (a communal tray holds all my Heliamphora, this plant and 6 other highland Neps. All the plants are placed on top of styrofoam blocks to keep them from standing in water.) I won't be performing the daily misting but weekly watering will continue.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •