User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 22 of 22

Thread: anyone have these

  1. #17

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Lol I aded one too many s`es lol,.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  2. #18

    Join Date
    Mar 2004
    Location
    I'm from Mississippi but I go to college In New Orleans
    Posts
    467
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    surprisingly my stepdad can help lower the temp. so im not worried bout nething.
    I love Vin Diesel!! *Growl* Nobody better talk bad about him or else!!!

    Squirdword-\"Why do today what you can put off 'till tomorrow.\"
    Mr. Krabs-\"What is today but yesterday's tomorrow.\"
    *~*Spongebob Squarepants*~*

  3. #19
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]thanx for the site i added it to my favorites list. well i know i said 7 seedlings, but i was just excited!! You're scaring me about N. jacquelineae. OMG is it that bad!!
    Well, we just don't know yet if it's that bad. It hasn't been in cultivation long enough. A few of us are growing it, though because of the price of the plant, I, for one, am very hessitant to test it's durability. Once it's big enough to take a cutting, THEN I'll see if it can take lower hudimidy, or whatever. If I don't trade the cutting for something else rare and expensive, that is!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #20
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    NepG isn't trying to scare you but more trying to emphasize that you really want to be sure you are proficient at growing easy Neps before embarking on anything that is slightly tempermental. N. jacq can be a tempermental plant, as a highlander it requires a nightly drop to the low mid to low 50s (something that is not easily accomplished in a dorm room) and humidity levels have to be fairly high. Lots of the highlanders are like this, hamata, diatas, lowii, ephipiata, etc and as such do not make good beginner plants. Now plants like alata, khasiana, gracillis, etc are more tolerant. They can take higher night temps, a wide range of humidity and light and are very forgiving of too much/too little watering and the like.

    Basically it all boils down to knowing your limits, like with any hobby. You should work your way up to the more difficult plants rather than just jump right in. Or, to use an analogy, you might think kayaking looks cool but that does not mean you go out and buy a kayak and then jump in and try to run a class VI rapid. First you learn how to paddel and roll in a pool and then work your way up from class I to class II to class III to class IV to class V and finally class VI. It might take years but at least you do it right
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #21
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Pyro, if I kayak a class II and a class III, does that mean I can say I did a class V?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #22

    Join Date
    Mar 2004
    Location
    I'm from Mississippi but I go to college In New Orleans
    Posts
    467
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol.
    I love Vin Diesel!! *Growl* Nobody better talk bad about him or else!!!

    Squirdword-\"Why do today what you can put off 'till tomorrow.\"
    Mr. Krabs-\"What is today but yesterday's tomorrow.\"
    *~*Spongebob Squarepants*~*

Page 3 of 3 FirstFirst 123

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •