User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Neps outside?

  1. #1

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,its going to be in the mid 80`s during the day,and low 60`s at night for at least the next week can my neps go outside at least during the day? The neps I have are N.sanguinea,N.ventricosa,and N.rafessiana.

    Currently they are growing together in a 10 in. hanging basket 2in. under a twin tube strip light in humidity averaging 69%


    Thanks for any help,
    pond-boy.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  2. #2
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The real problem is that each time you move a Nep to new growing conditions (light, temps, wind, humidity, etc) it must reacclimate to those conditions to begin growing well. By that time you may need to move them again to save them from cool fall and winter conditions, then they'll need to reacclimate in some new environment. Stable (and correct) conditions are required for continous "fast' growth and pitchering.

  3. #3
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I find Neps to be very tolerant of change. The key is they cannot go directly into bright sun for a while after being inside.

    Moving them out in rainy weather is best and I first put them out on the north side of the house, where they get first hour or so of sun in the morning and the last hour or so in the evening. After a week, they slowly migrate around the east side of the house to south side. Some hang in a tree, others hang from a trellis wire, and maybe one will hang from a post.

    I'd say I give them 3-4 weeks from the time they go out the back door until they are fully exposed to sun in the front yard. Mine are all highlanders.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    In my experience, neps tollerate temperature changes very readily, as long as the change isn't rediculous. They are much more picky about changing humidity. Also, Bruce is right about not putting them right into the sun from flourescents...many neps shouldn't ever get too much direct sun.
    So the real question is (to me, anyway): what's the humidity outside? If it's within a few % of the 69% you quoted, go for it....At least with the ventricosa and sanguinea... I don't know how well the raf would tollerate those cool night temps....I HEAR they don't mind, but have no direct experience (yet....I'm actually giving it a shot right now....night temps in the mid 60's. Too soon to tell). The problem with rafs that I have seen is thet are more fussy than your other two about humidity fluxuation.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am currently growing khasiana, faizaliana and (not really a) tobica outside in Atlanta and they are doing great. I moved them out of my sunporch about 2 months. The only issue I had was that some leaves got sunburned but that was my fault for not positioning them in the right spot.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Mar 2004
    Posts
    36
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can only speak from the point of vierw of hybrids. Having a mini green house makes the neps susceptible to sudden increases in temp. On one day the medium dried out when temps spiked resulting in the loss of a sanguine seedling. Otherplants were burnt or wilting - but has since recovered from the experience.

    From my understnding certain highlanders require stricter humidity or temps which I know I cannot provide with my setup. It really depends on what specises you're growing and it's hard to generalize as such.

  7. #7

    Join Date
    Apr 2003
    Location
    Central Coast, NSW, Australia
    Posts
    792
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Rocklizard:

    I tend to agree with your description. Many people can put their neps outside, because of factors involved which are somehow allowing a particular plant to grow:

    Humidity, light, temperature, shade, etc.

    We all not live under the same climate, therefore some of us can actually take their neps outdoors, others just can't.

    Even if you live in a hot area such as Arizona or central Australia, temperatures may benefit lowlanders such as bicalcarata and ampullaria, but the humidity is terribly low, so they'll fry away. I have also seen people growing highland neps in the colorado area such as Jeremiah. I was wondering if he ever tried to grow his ultrahighlands outdoor. My gut feeling is that the temperatures are too low or there is not enough light. Anyway, we just keep trying to optimize the conditions so one day, we can have our monster neps growing beside us.


    Gus

  8. #8

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks guys(or girls),I`m keeping mine outdoors on my patio hang ing on a nail where they get the first 1 hour and last 1 hour of direct sun every day and them bringing them inside for the night,I mist them at least once an hour when they are outside. Other then the newest pitcher burning on my N.ventricosa burning they all seem to be doing fine. The humidity averages about 50% during the day and 80% at night right now,but later in the year it will be around 70-90% all day(hot sticky Missouri summers!). I plan on keeping them outside day and night when night temps stay above 68 degrees.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •