User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: Saving nepenthes pollen

  1. #1

    Join Date
    Aug 2003
    Posts
    141
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Good Evening Folks,

    I am wondering what is the best way to preserve Nepenthes pollen when no other females are in flower? Can one put the opened flower stalk in a baggy and freeze it for several months, or does that render the pollen sterile? Curious because many times my male plants are in flower when my females are not and I would like to pollinate them at a later date. Finally, does the pollen virility decrease the longer each successive flower has stayed open? Any advice would be welcomed.

    Thanks greatly,
    Joel

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have heard that it can be stored in the fridge for a couple of months. Not sure if you're supposed to keep the whole flower or remove the pollen...My guess is you should remove the pollen.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You might want to try finding James Cokendorfer (not sure on that last name spelling) He was doing work on storing Nep pollen.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Aug 2003
    Posts
    141
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Space Cowboy,

    Thanks, I forgot I had James' email. He pretty much said to shake off the pollen onto wax paper and then transfer the pollen into a vial or container and air dry or fridge dry it. Then it can be stored in the freezer for a year. He said quick drying it in a cool place is best, like a fridge. Also, the more the smell the riper the pollen. I have noticed that when the neps are in flower they give off a rather unpleasant odor. So thanks for the tip. James also said he should have a paper on the subject coming out soon. Good job!

    Joel

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •