User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Some pics

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just wanted to share with you all.

    This is my hamata



    And my lowii



    ABG lowii in sphag



    And a close up



    An intermediate pitcher on the same lowii



    And a close up on this one



    This, I think, is trusmadiensis



    A "black" raff



    And a really nice mixta



    Hope you liked.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice pics!

    Man, I wanna go to ABG!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That N. lowii has gotten bigger last time I saw it in the late summer!

    Boy, N. x Miranda and N. x Mixta sure are similar!

  4. #4

    Join Date
    Aug 2003
    Posts
    1,163
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fine Photos, Pyro! The lowii pitchers on that carpet of sphagnum is beautiful. We really must get up there to ABG sometime soon.

    Dustin, Mixta and 'Miranda' really are quite similar. You really can't tell them apart until the plants are large and well established. To my eye, Miranda has more of a northiana influence to the mouth and peristome, even though the hybrid is (most likely) maxima x Mixta. Also, N. 'Miranda' leaves appear a bit wider in the length to width ratio.

  5. #5

    Join Date
    Jul 2004
    Location
    The Netherlands
    Posts
    174
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah the sphagnum is also awesome. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    About the lowii closeup. Are those the "white egg thingies" the lower pitchers have under the lid?
    [img]http://home.**********.com/users/phyrex/phyrex.gif[/img]

  6. #6
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Trent, maybe I could see what you're seeing if I had an N. x Mixta plant to compare my N. x 'Miranda' plant to. I've been searching for N. x Mixta for a while but no one seems to have it or want to trade it.

  7. #7

    Join Date
    Jul 2002
    Posts
    440
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nice images! ABG really does have some first rate facilities; we were there back in '99, and it was impressive even then. The N. lowii on display is quite nice; the person who donated it is quite generous, and I'm sure many of us know who he is!
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Quote Originally Posted by [b
    Quote[/b] ]I've been searching for N. x Mixta for a while but no one seems to have it or want to trade it.
    I have it, but won't have any cuttings for a while. Too bad you don't live near here -- such cuttings usually go in the trash, I'm sorry to say!
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Phrex,

    Yes those are the white egg thingies. Though some are yellow in the pic.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •