User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: Nep. low humidity experiment.

  1. #1

    Join Date
    Feb 2005
    Location
    Colorado
    Posts
    159
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm conducting a low humidity experiment on this Nepenthes X Ventrata. It's hanging in my bathroom window for about 3 weeks now. The second picture is of the humidty gauge I placed there for testing. The humidty ranges from about 40% to 55%, highest right after a shower, then over the next few hours it drops to a low of about 40%. The pitchers are not drying up after 3 weeks. Hopefully it will continue to pitcher once it completely acclimatizes to these conditions.




  2. #2
    Drew Mcclain's Avatar
    Join Date
    Feb 2005
    Location
    Southern California
    Posts
    125
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. x ventrata should pitcher in these conditions with no problem. I have found this species to be a wonderful house plant. Good luck!
    http://www.geocities.com/southerntropicals

    As the sun shine's through the clouds above the table top mountains,nothing more can be seen then a beautiful landscape of glowing Heliamphora's

  3. #3

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow it`s 130.9 degrees in your bathroom? Btw.nice looking ventrata:')
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  4. #4

    Join Date
    Jul 2004
    Location
    Michigan
    Posts
    581
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pondboy I think that is Military Time 1309 hrs 1:09 p.m.
    You don't need an iron chest if you have a sharp brain and a silk tongue.


    GROWLIST
    Wolf's Growlist

  5. #5

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh,I didn`t know they had clocks Lol.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  6. #6

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    very interesting, Elgecko once adapted a hamata to windowsill conditions, I've adapted byblis liniflora to these colorado conditions
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have many neps pitchering happily in similar conditions. 'Ventrata' is one of them... Also ampularia spotted, rafflesiana elongata (these two surprised the heck out of me!), 'Miranda', copelandii, eustachya, albomarginata, truncata x ventricosa...probably more that I forget right now...

    My humidity sometimes dips into the 30's....Once saw it at 27% [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    So, as you can see, many Neps are VERY adaptable. I'm quite sure they'll have bigger, more robust pitchers in the summer when they will get a higher sustained humidity level, but they're doing just fine for now.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a number of plants growing on windowsills here at work. Granted I am in Atlanta but the indoor humidity is really not that high. I have 'Effulgent Koto', vietchii, clipeata, 'Miranda' and ('Mixta' "superba x thorelli) x albomarginata and they are all growing and pitchering very well. I also have a raff on the windowsill at home and it is quite happy there.

    Persoanlly I think that so long as every other condition is met (i.e. heat, light, watering, etc) then humidity becomes less of an issue.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •