User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 16

Thread: Windowsill neps

  1. #1

    Join Date
    Jun 2004
    Location
    north carolina
    Posts
    91
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So, I need plants for the house and my terrarium is full. I have been looking into windowsill neps and wanted to know what you all thought. Ive checked out nepsaroundthehouse.com which is helpful but Id love to hear from all of you and maybe even see your house plants. I want to get a N. Truncata lowland...i know N. x Ventrata is another easy one. What else? Thanks

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Can you describe your living conditions a little?

    For most windowsillers, it's doesn't make much difference, but there are several neps that CAN be good candidates, depending on your ambient conditions.

    For example, if you live in Sanfrancisco, pretty much all highlanders, save a few REALLY picky ones, would qualify. If you live in Phoenix, your out'a luck.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Jun 2004
    Location
    north carolina
    Posts
    91
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, I live in Chapel Hill NC. So summers are hot and humid and the nights are usually pretty hot and winters get cold occasional freezes. But if they are indoors that wont matter. I figure maybe some lowlanders? although the house in the summer gets down to low 70s even maybe upper 60s. now in the winters the hous would be around 70s during the day and 60s to 50s at night.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    In that case you're looking for the typical tollerant nepenthes. Some highlanders like ventricosa, khasiana, sanguinea & alata will easily tollerate the summer highs & winter lows. There are also a couple of temperature tollerant lowlanders like ampularia and truncata if you can keep the humidity up a little bit (don't know how dry your winters get....ours get REALLY dry here in NY...I'm talkin 10 - 15% humidity)

    There are also some even hardier hybrids on the market like x 'Ventrata' and x 'Miranda.' These will take pretty much anything you throw at them (though won't pitcher in really low humidity, they won't die either).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Jan 2005
    Location
    La La Land (Los Gatos, Caifornia)
    Posts
    945
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I just made a topic about this a few posts down. Look for it.
    Update: Parents convinced to allow me to keep greenhouse heated over winter. Most species will not be lost. Too lazy to update growlist.

  6. #6

    Join Date
    Feb 2005
    Location
    Houston TX
    Posts
    975
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (schloaty @ May 17 2005,4:00)]In that case you're looking for the typical tollerant nepenthes. Some highlanders like ventricosa, khasiana, sanguinea & alata will easily tollerate the summer highs & winter lows. There are also a couple of temperature tollerant lowlanders like ampularia and truncata if you can keep the humidity up a little bit (don't know how dry your winters get....ours get REALLY dry here in NY...I'm talkin 10 - 15% humidity)

    There are also some even hardier hybrids on the market like x 'Ventrata' and x 'Miranda.' These will take pretty much anything you throw at them (though won't pitcher in really low humidity, they won't die either).
    For hybrids, I have N. miranda, N. coccinea, and N. 'Judith Finn'.

    They all survive in my typical household conditions, but the N. coccinea flourishes, and pitchers readily.

    I live in Houston TX. The plants are in a south-facing window, with a bamboo shade which gives about 60% shade. I have them hanging in 8" pots, with a drip tray. I never let the drip tray dry.

    I recently started misting them, and saw no difference.

    I moved the N. 'Judith Finn' to my grow chamber, and it is pitchering like crazy now.

    The N. miranda very rarely pitchers, maybe once every 8 weeks, wheras the N. coccinea produces about one new pitcher every week.

    The house is always air conditioned, so it's low in humidity. The drip tray dries out very quickly.

    I have heard that N. ventrata does well, too, but I have no experience with it.
    My Grow List

    "We are just an advanced breed of monkeys on a minor planet of a very average star. But we can understand the Universe. That makes us something very special." -- Stephen Hawking

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Aha! Sar Scott, you live in TX, which is lowland terratory all the way...thus your coccinea does well (lowland hybrid). I get cooler nights (usually), thus my miranda does very well (since this is an intermediate by way of the parrents). I bet if you move your miranda to where it gets cooler nights, it will stun you.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have grown the following in windows here in Atlanta and all have done well:

    N. rafflensia "Singapoe Giant"
    N. cv ‘Effulgent Koto’ (5778)
    N. (thorellii-JAM x LCS#1 superba-mixta) x 9/12/1983-LCS#1F albomarginata#1 (5850)
    N. 'Miranda'
    N. clipeata
    N. veitchii “Stripped peristome; lowland"
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •