User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 6 12345 ... LastLast
Results 1 to 8 of 47

Thread: Evolution of nepenthes

  1. #1

    Join Date
    Jul 2004
    Location
    Bavaria
    Posts
    93
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi there,

    has the evolution of Neps stopped 200 million years ago? Or are there any new mutations?

    Cheers,
    Max

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Max,
    I would be willing to bet you that in that much time, there have been mutations. However, remember that mutations most of the time are tiny little changes that are barely, if at all, perceptable.
    200 million years is a LONG time.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Feb 2005
    Location
    Houston TX
    Posts
    975
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Flowering plants only emerged 135 million years ago.

    All the diversity in flowering plants you see today has occurred in that time.

    Evolution is a constant, gradual, ongoing, constant process, and it is still happening today.
    My Grow List

    "We are just an advanced breed of monkeys on a minor planet of a very average star. But we can understand the Universe. That makes us something very special." -- Stephen Hawking

  4. #4

    Join Date
    Aug 2003
    Posts
    1,163
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Absolutely. Signs of divergent evolution are certainly visible in Nepenthes. As an example, the group of mirabilis forms found in northern Queensland, Australia. These are Nepenthes all specializing for survival within the slight variations of habitat in the 'wet desert'. Even rowanae is showing a fairly wide set of variations. Same could be said about the smilesii, thorelii, kampotiana, anamensis, now add Viking. Personally, I believe this is a snapshot of Nepenthes evolving and moving into a monsoonal zone, all most likely since the last ice age. They are different from their kin in the pertropical zone.

  5. #5

    Join Date
    Feb 2005
    Location
    Houston TX
    Posts
    975
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Trent, you seem knowledgable about this... when did Nepenthes emerge?

    I am guessing they are fairly recent.
    My Grow List

    "We are just an advanced breed of monkeys on a minor planet of a very average star. But we can understand the Universe. That makes us something very special." -- Stephen Hawking

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Given the show I saw on the Seychelles on PBS a couple weeks ago Neps have been around at least since the Seychelles and Madagascar were part of the same land mass which I believe was between 160 and 65 mya. I think the show mentioned that N. pervillei was one of the earliest Neps (evidenced by the nature of its fruit and how the seed is totally different than that of "normal" Neps) and has basically remained unchanged since ~80mya [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Aug 2003
    Posts
    1,163
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't think any of it is very well defined, but I have read that Nepenthes emerged after the catastrophic extinctions that ended the Cretaceous. This is when flowering plants (and mammals) very suddenly burgeoned. I've heard the same statements about pervillei being the most primitive, and thus, probably most unchanged for millions of years. Or is it the chicken and the egg? Maybe pervillei has simply evolved to its state for survival. Island evolution can be extreme because of isolation. Danser believed that Neps probably originated in Madagascar and spread to their current distribution. Would that make madagascarensis the oldest species? Over the millions of years, can you imagine how many times species of Neps evolved, and then went extinct as climate changed, only to be replaced by a new set of species?

  8. #8
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    if N. madagascarensis is the oldest, that's interesting since it's rather unremarkable, unlike N. hamata or N. platychilla or others.

    evolution doesn't try to make things the best they can be, it tries to make them good enough for right now.

    not that i think of it, would you consider humans messing around with nepenthes being indirectly responsible for their evolution in culture?

Page 1 of 6 12345 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •