User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: ok, new U. Livida question

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Now that my U. Livida is flowering quite profusely (spelling? stupid english language), and getting frequented by these cute little green bees, how long to seeds? How do I know if they are ripe?
    Thanks! And by the way, if I mange to harvest these correctly, there will be some available for trade (will post there when appropriate).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't know exact times but I would guess at a few weeks. Watch the seed pod and when it gets dark it is ripe. If you plan on getting the seeds to others you will need to do it fast as they are really short lived
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I've never had seed on U. livida. Of course, I've never tried pollinating it either.

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Likewise. You will know if pollination has occurred if you see the seed capsule form: they are like little balls on the scapes. Although I wish you luck, try not to get your hopes too high as I believe these species have fairly specific pollinators.
    "Grow More, Share More"

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    Specific polinators? Does that mean the bee I saw enjoying the flowers couln't have politated them? Or is it just unlikely? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

    I thought that anyone visiting a flower could carry the pollen....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Similar Threads

  1. U. livida
    By kayaker78 in forum Carnivorous Plant Trading Post
    Replies: 4
    Last Post: 11-05-2004, 06:27 AM
  2. U. livida
    By kayaker78 in forum Utricularia, Aldrovanda, Genlisea
    Replies: 12
    Last Post: 10-04-2004, 02:50 AM
  3. U.livida
    By Colieo in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 02-03-2004, 06:45 PM
  4. U. livida
    By nepenthes gracilis in forum Utricularia, Aldrovanda, Genlisea
    Replies: 5
    Last Post: 07-16-2003, 12:13 PM
  5. U. livida?
    By Vic Brown in forum Utricularia, Aldrovanda, Genlisea
    Replies: 9
    Last Post: 06-25-2003, 01:38 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •