User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: U Livida flowering like mad

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Anyone know what signs to look for that will tell me it's time to harvest?

    TIA [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I've never had U. livida set seed. In other utrics, the pods turn brown and crack open when they are ready.

    The seeds aren't very desirable anyway as it much easier to just grow it from cuttings.

    tim.

  3. #3

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My livida has been flowering non-stop since April 2001 when I got it. I like the fact that it doesn't self seed. Self seeding Utricularia need to be kept away from other Utricularia or there is the danger of the seed falling into the pots of other species, uhhh, is that clearer than it sounds? Subulata is the worst, and I am now worrying abut lateriflora which has appeared in some pots of droserae: I hope it isn't already too late. Other potential problems in my collection are arenaria and dichotoma "Nova Zelandiae", both of which self seed for me.

    I agree with Tim, why bother with seed? A small start of the plant will soon fill a pot. Sometimes I think you have a better chance of winning the lottery than getting Utricularia seed to germinate.

    BTW Tim, have any of your new germination techniques resulted in better germination? Ga3 has proven to be equally ineffective in my limited experience with using it on Utricularia and Genlisea. My next experiments will be with petrie glass, possibly the instense humidity might play a role in getting it to start.
    "Grow More, Share More"

  4. #4

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nope, nothing. I have only ever had any luck with really fresh seed, and then it has germinated within a few weeks. But there are stories of utric seed germinating after many months. I just don't have that kind of patience. I figure that if someone is in a position to collect seed, then they can bloody well take a chunk of the plant as well, and save us all some grief.

  5. #5

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Amen to that thought!
    "Grow More, Share More"

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    ok ok ok!!

    I won't harvest the seeds! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

    I'll just split the sucker and repot a portion...
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It really is much easier that way [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Similar Threads

  1. U. livida
    By F R e N c H 3 z in forum Utricularia, Aldrovanda, Genlisea
    Replies: 18
    Last Post: 07-24-2009, 09:45 AM
  2. 'bout when does U. livida start flowering?
    By Drosera36 in forum Utricularia, Aldrovanda, Genlisea
    Replies: 21
    Last Post: 12-07-2005, 05:15 AM
  3. U livida
    By Daniel in forum Utricularia, Aldrovanda, Genlisea
    Replies: 4
    Last Post: 08-21-2003, 01:14 PM
  4. U. livida
    By kayaker78 in forum Carnivorous Plant Trading Post
    Replies: 32
    Last Post: 07-24-2003, 08:05 PM
  5. Livida
    By Jmenprkr in forum Utricularia, Aldrovanda, Genlisea
    Replies: 5
    Last Post: 07-19-2003, 07:41 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •