User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: U. livida?

  1. #1

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I received this plant at a CPS meeting in the UK a couple of years ago as Utricularia tricolor, it soon became obvious that it wasn't that species and I have been assuming that it is a form of U. livida, but I'm not sure (I know U. livida is a very variable species). The leaves are similar in shape to U. livida, but about twice the size as the form I grow. Another important difference that may help I.D. this one, is that it is self-fertile, producing plenty of seed. If anyone knows what it is, please post here.





    This is the form of U. livida I grow.



    It really is time I saved up for a copy of Taylor's Utric book

    cheers

    Vic
    They say that money talks, but all it ever says to me is goodbye.

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Vic,
    I'm far from an expert here, but I'm pretty sure that U. livida is not self fertile. I grow this species, and I can't get it to seed at all, even with bees visiting the flowers.

    That said, the flower is strikingly similar....Are there such a thing as Utric hybrids? [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Vic,

    I'm not an expert either, but I can tell you for certain it isn't tricolor - here's a pic of tricolor leaves:



    It does look like u.livida to me, I had one plant hiding in my u.sandersonii (some of which I accidentally gave to larry). Looks a lot like u.sandersonii in the shape of the leaves but in the flower it simply doesn't have the ears. I don't have a pic with me at the moment, but I'm sure someone will post soon. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    A flytrap ate my homework!
    -Michelle

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Vic,

    I'm guessing that the last pic is a comparison between your typical form and this oddball?

    I believe this is a livida form as well. I have a 'S. Africa colour varient' form whose leaves are almost identical to the description you give. The flowers on mine are a little less blue but that could just be light. The self fertile thing is new to me but there are other Utrics that are so it is in the realm of possibility.

    Scholaty,

    There are reports of Utric hybrids but I only know of 3. 2 of them are purported mega-Utric crosses (alpina x endresii and humboldtii x quelchii.) To my knowledge no one has flowered the first so it isn't 100% for sure and the the second I have only seen pictures of so it could be bogus for all I know. Then there is the one BestCP sells (praelonga x livida I think) and I have heard it is identical to praelonga. So...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm fairly sure it's U. livida too, it's just the seed production that has sown doubt in my mind. I suppose it is always possible that some unseen pollinator is crossing my two different clones, but it's only this larger blue-flowered form (possible 'Durban' ?) that seed sets and it now growing in several other pots (I didn't expect it to be a weed [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img])

    Vic
    They say that money talks, but all it ever says to me is goodbye.

  6. #6

    Join Date
    May 2003
    Posts
    102
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U. livida and sandersonii are very closely related - perhaps they might hybridise. U. praelonga x livida sounds very dubious - are there photos of humboldtii x quelchii on the web anywhere?

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Giles,

    There used to be. Try a Google search or an MSN search (I can't remember how I turned it up.) I'll see if I can find it too and post a link.

    Vic,

    I'll check my taylor when I get home and see what it says. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    kayaker78's Avatar
    Join Date
    Feb 2003
    Location
    Salt Lake City, Utah
    Posts
    348
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I recognise the plant in that pic! Its U. livida 'Merriwuk, Natal, SA'

Page 1 of 2 12 LastLast

Similar Threads

  1. U.livida
    By Colieo in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 02-03-2004, 06:45 PM
  2. U. livida
    By Tamlin Dawnstar in forum Utricularia, Aldrovanda, Genlisea
    Replies: 19
    Last Post: 08-27-2003, 04:04 AM
  3. U livida
    By Daniel in forum Utricularia, Aldrovanda, Genlisea
    Replies: 4
    Last Post: 08-21-2003, 01:14 PM
  4. Livida
    By Jmenprkr in forum Utricularia, Aldrovanda, Genlisea
    Replies: 5
    Last Post: 07-19-2003, 07:41 PM
  5. U.livida
    By magore in forum Utricularia, Aldrovanda, Genlisea
    Replies: 4
    Last Post: 07-17-2002, 05:48 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •