User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: What the @?!$ is a ultric

  1. #1

    Join Date
    Jul 2002
    Posts
    26
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Talking

    you keep on talking about them what are they

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Bladderworts. They grow these neat (very little) traps, usually under water or under muck. The traps act like vaccum seals, when the trap is triggered, there is a brief, powerful suction (sucktion? suck-shun? oh, forget it) that pulls in whatever triggered the trap. I think most aquatic types catch a lot of water fleas, and terestrials catch whatever little critters live in the muck.
    Hope that helps! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Schloaty covered most of it but for clarification:

    UTRIC is short for UTRICULARIA the genus name for the bladderworts

    For more info on them check out the CP FAQs page.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    They have some of the most beautiful flowers of all CP, although often small, they are better than orchids IMO. Also this genus is probably one of the most evolved plant forms on Earth. Mprphologically, they have no roots or leaves, but rather modified stolons (stems actually) that perform the functions that leaves and roots do in other flowering plants. They are the most widespread geographicaly of all the CP, and have the greatest number of individual species.
    "Grow More, Share More"

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •