User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: Genlesia

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hey, can anyone tell me what the trapping mechanism is on the genlesia? I did a search, and found a couple of pictures that weren't helpful, and some scientific gobledegook.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Genlisea have a corkscrew type of trap, and prey is often almost microscopic. There is no activity to the traps: prey (often the genus Monarda) work their way down the traps, the shape prevents their escape: they can go down, but not back.
    "Grow More, Share More"

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually there is some preliminary rersearch that Genlisea actually have an active suction to pull prey in. Check out the CP FAQs for more info
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Build your own genlisea trap:

    Take a sarracenia pitcher, turn it upside down, cut a slit down each side, give it half a dozen twists, shink it down to a few inches long.

Similar Threads

  1. Genlesia hispidula
    By rubrarubra in forum Utricularia, Aldrovanda, Genlisea
    Replies: 3
    Last Post: 05-27-2004, 04:00 AM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •