User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: Angry angry angry

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have lost my G. filiformis [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img]

    It was fine Saturday night, green lush and everything. Yesterday, around noon, it was a slimy grey mess. I have no clue what could have killed it so fast but I am glad it was in isolation because I would hate for whatever it was to spread to my other Genlisea.

    Not happy at all
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Wink

    Bummer, man. Sorry to hear about that.

    Off the topic....Is there any connection between the G. Filiformis and the D.Filiformis? Named/discovered by the same person? Just curious.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry to hear about the plant.

    Schloaty, filiformis is a description of what the plant looks like, specifically threadlike leaves.

    Check this website, it has a very good list of latin carnivorous plant names:
    http://www.flytrap.demon.co.uk/cpdict.htm

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    ooooooohhhhhhhhhh. Boy, do I feel silly. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Thanks! I always wondered about that.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Oct 2002
    Posts
    115
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry to hear the Pyro. Sounds like what happends when a plant gets to cold and then is warmed back up.






    _-West-_

  6. #6

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Isn't G. filiformis an annual species? I wish I could help you out, but the start you send failed to make it. I am hoping to get another start sometime, and will share with you if it happens:-)
    "Grow More, Share More"

  7. #7

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's too bad. My plants seem to be growing okay, but they don't look as fantastic as when I got them.

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Dodec,

    About the only advice I can give is: keep an eye on yours. I am thinking of emailing our source and asking them how they cultivate theirs, if I get a second go at this plant I want to make sure I succeed
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Similar Threads

  1. The Angry Pharmacist
    By Clint in forum General Discussions
    Replies: 10
    Last Post: 05-28-2008, 10:25 PM
  2. angry
    By droseradude in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 4
    Last Post: 06-14-2006, 06:06 PM
  3. Relly sad/mad/angry!
    By Cha in forum General Discussions
    Replies: 10
    Last Post: 04-17-2006, 08:12 PM
  4. Angry alien productions
    By Amateur_Expert in forum General Discussions
    Replies: 3
    Last Post: 03-07-2005, 10:34 PM
  5. A angry sea gull...
    By Spectabilis73 in forum General Discussions
    Replies: 7
    Last Post: 11-13-2002, 07:08 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •