User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 5 FirstFirst 12345 LastLast
Results 9 to 16 of 34

Thread: Epiphytic?  utrics?  reeeeeaaaaallly?

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Dodecs point is very valid although I do contend that at least some are temperature sensative. I know my aslpundii refused to grow until the temps dropped below 70.

    I use the term 'difficult' in the same manner I might for a highland Nep. If you can provide the right conditions then you are fine but if you can't then these guys really will be 'difficult' Under these same terms any plant has the potential to be difficult, I know people like Fatboy say Sarrs are difficult because they just can not be grown in Sri Lanka.

    I feel your need for a greenhouse Dodec
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Smile

    Thanks for the tips, everyone. I think I will hold off before I try any of these out. If (well hopefully WHEN) I get a house, and subsequently a greenhouse, I will try them out.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I say start now with something similar. See if you can get your hands on a U. longifolia, these guys are similar but a lot more tolerant. If you can grow it then try for the alpina [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    Moderator Colieo's Avatar
    Join Date
    Jul 2002
    Location
    Indianapolis, Indiana, USA
    Posts
    724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I only grow one of the above, u.humboldtii, and it is very easy with no real special treatment. I cant compare though... my only other utric is u.gibba [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] & I think they are probably one of the most interesting CPs.

    Cole
    Duele no tenerte cerca, duele no escuchar tu voz. Duele respirar tu ausencia, pero, duele más decirte adiós.

  5. #13
    gardenofeden's Avatar
    Join Date
    Sep 2001
    Location
    England
    Posts
    382
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U.nelumbifolia is easy, and very fast growing.
    Stephen
    Sarracenia rosea?...don't be ridiculous!

  6. #14
    Guest
    I recently acquired humboltii- Savage Garden says to keep them waterlogged... does anyone having experience with this plant have any suggestions for watering?

  7. #15

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have mine in sphagnum in a 4 inch pot. Water level varies between right up to the soil surface and halfway up the side of the pot. It doesn't seem to be too picky. I have only had mine for about 6 months or so though. I grow U. nelumbifolia with similar conditions.

  8. #16

    Join Date
    Nov 2002
    Posts
    11
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    thanks!

Page 2 of 5 FirstFirst 12345 LastLast

Similar Threads

  1. I'm breeding dart frog      food, fruit flys
    By Spectabilis73 in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 8
    Last Post: 02-18-2004, 07:09 PM
  2. aquatic utrics.  peat in water or filter?
    By adnedarn in forum Utricularia, Aldrovanda, Genlisea
    Replies: 4
    Last Post: 11-04-2003, 10:10 PM
  3. Where is that darn         link!
    By Spectabilis73 in forum General Discussions
    Replies: 4
    Last Post: 02-27-2003, 10:36 AM
  4. Found a whole bunch of  aquatic utrics
    By jodajo21 in forum Utricularia, Aldrovanda, Genlisea
    Replies: 3
    Last Post: 11-04-2002, 03:53 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •