User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 5 12345 LastLast
Results 1 to 8 of 34

Thread: Epiphytic?  utrics?  reeeeeaaaaallly?

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Quote
    Utrics are very diverse having evolved to be aquatic, terrestrial and epiphytic.[/QUOTE]

    I was not aware that Utrics could be epiphytic...Are these easy to cultivate? I am really intrigued...Can they be grown off a nep (or any other cp for that matter), or do they have to be submerged?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Think crotch of a tree, with leaf litter collected in it...

    I believe, but probably am wrong (so take it however you like), that they are difficult for the most part...

  3. #3

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There's a little basic info on the epiphytic species in the Savage Garden. As Parasuco said, some of them can be difficult, or at least require certain conditions (highland), and some are very slow growers as well. They tend to have larger flowers, and be somewhat less common than most utrics. think one species often grows in bromeliads in the wild. Overall, I think they're some of the more interesting utrics. A few people posting here grow some, and I think longifolia is the most common species in cultivation (and it doesn't seem like a hard plant to grow so much as a frustratingly slow plant - I can't even imagine how frustrating the slower growing species must be).

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The epiphitic Utricularia are beautiful in flower! They are also very rare for good reason: they are difficult species to cultivate, requiring a cyclic growing regimen with close attention to a dry dormancy. I have had success with U. alpina and humboldtii, the only epiphites I have had the pleasure to acquire. Utricularia longifolia is not epiphitic, and is an easy grower compared to the other members of the section. These plants are best left to experienced growers, the plants are usually expensive when they are comercially offered. A good starting subject would be U. alpina which is a little more forgiving than most.
    "Grow More, Share More"

  5. #5
    Moderator Colieo's Avatar
    Join Date
    Jul 2002
    Location
    Indianapolis, Indiana, USA
    Posts
    724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U. humboldtii also grows in the boggy parts of its habitat too, so it grows as an epiphite, or as a terrestrial utric.

    Cole
    Duele no tenerte cerca, duele no escuchar tu voz. Duele respirar tu ausencia, pero, duele más decirte adiós.

  6. #6

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U. humboldtii usually grows as a terrestrial (or so I've heard), but sometimes as an "epiphytic aquatic" in the pools in the axils of bromeliads. Apparently U. nelumbifolia grows more commonly in bromeliads.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The epiphytic Utrics are:

    U. alpina
    U. asplundii
    U. unifolia
    U. quelchii
    U. endresii
    U. jamesoniana
    U. praetermissa
    U. buntingiana
    U. campbelliana

    And often people clump in the Iperua section with them though technically these are not epiphytic

    U. reniformis
    U. humboldtii
    U. nephrophylla
    U. nelumbifolia
    U. geminiloba

    Many/most of the true epiphytes grow in moss on trees or cliffs in places like Parasuco described. Some also grow as terrestrials but not too often. As Tamlin noted, these plants have very specific requirements for their cultivation in reguards to dormancy, but each species seems to have different requirements. U. endresii must be kept fully dry when dormant while U alpina can be kept some what damp. Few of these have been in cultivation long enough for growers to get a good idea of each species requirement. The majority of these plants fall into the highland catagory so they require a drop in temperature at night that is also difficult for many growers to provide.

    As Tamlin said, these plants are not for the beginner. I would agree that U. alpina is probably the best starter plant for this group and if you can grow it well I would then suggest asplundii.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There seems to be a phenomenon where plants get a reputation for being difficult when first introduced that tends to stick around. Look at Slack's comments about genlisea and heliamphora in "Insect-eating plants".

    The South American mega-utrics are all slow growing, and you need to be confident that your conditions are right for them, since they are slow to respond to experiementation. The problem for a lot of people, in my opinion, is that most people are forced to start with very small portions, in proportion to the fully grown plant. Imagine if you had to start a colony of U. sandersonii from a couple short lengths of stolon with just a few leaves on it.

    I have had pretty good luck with this group (knock on wood). Even odd ones like U. quelchii grow slowly but surely. My philosphy so far is to keep them wet enough that they never dry out, but not so wet that they would rot if they went dormant. Kind of like a houseplant - I water them when they moss starts to dry out a bit on top.

    What I really need is a greenhouse.

  9. Page 1 of 5 12345 LastLast

    Similar Threads

    1. I'm breeding dart frog      food, fruit flys
      By Spectabilis73 in forum Reptiles, Amphibians and other terrarium dwelling animals
      Replies: 8
      Last Post: 02-18-2004, 07:09 PM
    2. aquatic utrics.  peat in water or filter?
      By adnedarn in forum Utricularia, Aldrovanda, Genlisea
      Replies: 4
      Last Post: 11-04-2003, 10:10 PM
    3. Where is that darn         link!
      By Spectabilis73 in forum General Discussions
      Replies: 4
      Last Post: 02-27-2003, 10:36 AM
    4. Found a whole bunch of  aquatic utrics
      By jodajo21 in forum Utricularia, Aldrovanda, Genlisea
      Replies: 3
      Last Post: 11-04-2002, 03:53 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •