User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: Seeking a little info

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Guys, I was just the fortunate recipient of quite a nice package from Vertigo. In it there were several utics that I am unfamilliar with, and my google searches are oh-so frustrating.....I wonder if anyone could give quick care synopsis of any of the following:
    longifolia, lateriflora, 'Mrs. Marsh,' tridenta, 'Asenath Waite,' calcyfida, tricolor, 'Lavina Whatley' and bisquamata.

    Any tips greatly appreciated!
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This should at least narrow it down a bit.

    'Mrs. Marsh', 'Asenath Waite,' and 'Lavina Whatley' are all cultivars of calcyfida.

    Longifolia is a tropical if i'm not mistaken.

    The rest as far as I know, heck, keep them all wet. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    Lithops care info: If you take care of it, it will die.

  3. #3

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U. 'Mrs. Marsh', 'Asenath Waite' and 'Lavina Whatley' are all cultivars of U. calcyfida, bred by Barry Rice. U. calcyfida likes warm, shady and humid conditions, I grow mine at the back of my lowland nepenthes terrarium. See the links on this page for details of these cultivars and Barry's paper on U. calcyfida, as well as lots of other useful online publications Barry Rice's Publications.

    U. lateriflora is an easy to grow terrestrial Utric from Australia and U. bisquamata is an easy S. African. Both of these species are self-pollinating in my collection, and care should be taken, so that don't invade neighbouring pots. I find mine grow and flower well under the same conditions as most easy, small terrestrials such as U. sandersonii in peat/sand, kept wet.

    I find U. tricolor likes it a bit wetter than some terrestrial Utrics, and grow it with the water level with the soil surface most of the time. It's easy enough to grow, but tricky to get the conditions right for flowering (at least it is for some! ). See this recent thread, U. tricolor.

    U. longifolia is one of the 'larger-flowered' S. American Utrics that I find grows well in an mix of LFS, peat and perlite (1:1:1). I keep wet-damp rather than flooded.

    I haven't grown my U. tridentata long enough to offer much advice, I'm just growing it in peat/sand, like the other small terrestrials.

    Vic
    They say that money talks, but all it ever says to me is goodbye.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks a bunch guys! That's very helpful info. Now maybe I won't kill them..... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I`m pretty sure that longifolia is an epiphetic species.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  6. #6

    Join Date
    Jan 2002
    Location
    Southern CA, US
    Posts
    1,058
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It is not from what I have heard.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    U. longifolia is a terrestrial plant by habit, CP2k is correct, however it is also known to grow epiphytically and sub affixed.

    I believe the confusion Pond Boy has is a mistake that is often made, that of thinking longifolia as an epiphytic becaue it has large flowers like U. alpina, endresii and the like and these plants are commonly refered to as the "epiphytes" (a term that is also misapplied here as the majority of these groe as terrestrials as well.) D'Amoto made this same mistake in his book and since it is commonly refered to as the CP bible it is easy to understand how this mistake has a life of its own
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The confusion extends back at least as far as the previous CP Bible "Carnivorous Plants" by Adrian Slack, published in 1979. I assume that this is where the confusion first arose, and has simply been propogated (pun not intended) by D'Amato.

Similar Threads

  1. Seeking VFT Seeds
    By BurntSnow in forum Carnivorous Plant Trading Post
    Replies: 3
    Last Post: 07-21-2010, 07:22 PM
  2. Seeking Darlingtonia
    By Wesley in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 07-22-2007, 08:06 AM
  3. Seeking Droserae
    By setep in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 07-30-2006, 05:56 PM
  4. Seeking info on endemic flora
    By Frederick in forum Conservation Station
    Replies: 0
    Last Post: 08-09-2004, 01:16 PM
  5. Seeking
    By Pyro in forum Carnivorous Plant Trading Post
    Replies: 1
    Last Post: 11-04-2003, 01:47 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •