User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 12 of 12

Thread: ok, quick U. Lividia question

  1. #9

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Can you get a photo for us? I know utrics are tricky to photograph and it might not be possible.

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    In my experience, the trick to getting decent photos of Utric flowers is to get the camera as close as possible to the bloom before you try using the zoom.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I've only ever used digital cameras to photograph plants, so I just used the macro mode and tried to get as close as possible and still focus. A lot of trial and error.

  4. #12
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    I will try to get a hold of my sister in law's digital camera...I need it anyway for the rest of the collection! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 2 of 2 FirstFirst 12

Similar Threads

  1. Quick Question
    By SnowyFalcon in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 07-28-2006, 12:04 PM
  2. Quick question
    By dewy in forum General Discussions
    Replies: 11
    Last Post: 04-27-2006, 08:35 AM
  3. Quick question
    By prizmbatch in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 4
    Last Post: 08-24-2005, 04:30 PM
  4. Quick question................
    By rattler in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 07-29-2004, 11:08 PM
  5. Quick question =)
    By myke66 in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 5
    Last Post: 10-13-2003, 11:06 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •