User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: ok, quick U. Lividia question

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    My Lividia(s?) is has tons of really cute white flowers. however, there are also some rather cool purple ones. Does this mean I have more than one plant, or can one plant produce different colored flowers?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah, that sounds normal. Livida (only two 'i's) flowers will be purple if they have lots of light, white if they don't.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I will say that it isn't the darkest purple, mine are in full sun and you can only just detect a hint of purple flush
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Smile

    My purple ones are really purple! Wish I had a digital camera! Also, there are a LOT of blooms....Is that normal? Not like I'm complaining [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] just cecking.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Purple like the one on the BestCP photo gallery? If that is the case then I am going to guess that you managed to get both colour forms. But that is just a guess.

    And yes, lots of blooms is normal [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Where did you get it from? U. arenaria looks a bit like a purple U. livida.

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Wink

    I actually got it from a different on-line nursery (this was before I discovered this sight). I don't really think I should post their name, but the plants I got were all healthy.

    What you say about a having other forms/species Is quite possible....there were many stow aways in my pots when I got the plants. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Anything is possible I guess. But usually one species will tend to overwhelm another (hence the reason we all hate U. subulata [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] )

    I do know of a grower that has told me of their subulata has both white and yellow flowers so there is also the possibility that you have an odd mutant doing something like that.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Similar Threads

  1. Quick Question
    By SnowyFalcon in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 07-28-2006, 12:04 PM
  2. Quick question
    By dewy in forum General Discussions
    Replies: 11
    Last Post: 04-27-2006, 08:35 AM
  3. Quick question
    By prizmbatch in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 4
    Last Post: 08-24-2005, 04:30 PM
  4. Quick question................
    By rattler in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 07-29-2004, 11:08 PM
  5. Quick question =)
    By myke66 in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 5
    Last Post: 10-13-2003, 11:06 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •