User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 5 FirstFirst 12345 LastLast
Results 25 to 32 of 35

Thread: Strange humboldtii growth?

  1. #25
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Tamlin, did the typical leaves start out as small ones? Since the plant has been in the sun it is putting put small leaves that look like minitures of the typical humboldtii leaves.
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  2. #26

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mine started with only the grass like leaves, then formed some at the surface, just as in your photo. Then suddenly, normal leaves were produced.
    "Grow More, Share More"

  3. #27
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Have you checked the sources of the two different types of leaves to make sure they were the same? Could always be humboldtii infested with praelongia....

    Who knows. We'll see what mine puts up as it starts growing here soon.

  4. #28

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    No chance of infestation, as I mentioned, the plants were never adjacent or even close to each other, and neither have ever flowered for me.

    It's U. humboldtii, honest. If it isn't, I'll come to the first Terra Forums Clambake in a dress, and drink the contents of a S. purpurea. On stage.
    "Grow More, Share More"

  5. #29
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually Jan makes a good point and in this case I might be to blame because I grew the two species in close proximity to each other. It still seems odd that one would give way to the other though. I still think it is a mutant [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #30

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmmmmm. Now you have ME wondering Pyro. I guess we will have to check it with Tim, as I have a distinct recollection (which may mean nothing) that he said he has experienced 3 different leaf forms in U. humboldtii. Meanwhile, if any of the clones from my plant suddenly begin producing typical leaves for the species, then I will have to think it unlikely I could have sent both, since the cutting I gave to copper was not large. Like I have said, these are sneaky plants, and it may be I got a two for one deal, but I still doubt it. Maybe I could get a look at the bladders which should nail it since I can trace the grass like lolon back to its origin beneath the surface, and I also grow a completely different clone that I can swear has never been anywhere near U. praelonga. Just tell me what the difference would be between the two, and I will have a look see. I hate mysteries.
    "Grow More, Share More"

  7. #31

    Join Date
    Nov 2003
    Location
    San Francisco, CA
    Posts
    237
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Both U.parelonga and U.hispida have such dimorphic leaves, but can't say if U.humboldtii does this too. Very curious if it does. Well, to get a good ID, you could do some sort of DNA analysis, hehehehe!

    Take care,
    Fernando Rivadavia

  8. #32
    jack's Avatar
    Join Date
    Mar 2002
    Location
    western Oregon
    Posts
    298
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    bumped

    Did anyone figure out if this plant was U. humboltii or U. pralonga mixed in. Jack
    'Celebrate the birth of our nation by blowing a little piece of it up'.The Simpsons.
    My grow list ~http://www.terraforums.com/forums/sh...d.php?t=107403

Page 4 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •