User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: Utricularia jamesoniana

  1. #1

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just wanted to say that so far, the plant is proving very ammenable to my culture on a moist to wet medium. Caution has been advised though, although the growth is excellent, the plant might not form its characteristic tubers that will carry it through dormancy. Based on this, I get the feeling that there will be a window prior to dormancy where a very gradual drying will be needed to translocate the reserves stored in the plants leaves to form the storage tubers.

    This seems to be a similar case as with U. geminiloba, which I grow just moist when there is no visable and active growth. When I notice new growth, I increase the water until it is a few CM deep in the jar I have it in, raised from the bottom on osmunda. At this time, the plant goes crazy, growing through the osmunda and into the water at the base of the jar. So, I believe from what I am seeing that U. jamesoniana is likely a seasonal hydrophyte, enjoying the water. Once growth stops, I plan on reducing the moisture level to moist, with occasional drenches, afterwhich the excess water will be poured out of the container. This has served me well for my culture of U. geminiloba (although I have yet to flower it).

    So far so good. The plant is growing very well, and has nearly doubled in size, but there are no new tubers. The question now is, do I continue the wet culture straight on, or try to encourage tuber formation now during the period of active growth? Like I said, I sense there is going to be a window of time where the plant will need time to make those tubers before going dormant. In U. geminiloba, there is very little sacrifice of leaves when growth stops. If this proves to be the case with U. jamesoniana, we have it made! If the leaves are non-persistent during dormancy as a gene controlled or light activated process, and only the tubers remain, then it is critical to find a way to encourage tuber formation before the leaves disappear.

    It's never to early to worry about the dormancy issues. Sebastian, if you can would you ask Peter his thoughts on this? He is the only one I know with hands on experience with long term growing of the plant. Ask him if the leaves persist for him, or vanish during dormancy, and if he does anything to change his conditions to encourage tuber formation.

    Things can always change in an eyeblink, but for now, I have to say things are looking good!
    "Grow More, Share More"

  2. #2
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fantastic news indeed Tamlin! Unfortunately I don't have alot to add.. I have U. alpina growing amoung the Nepenthes that I just let sit there but not sure if this would work for U. jamesoniana. Perhaps if kept moist it might not go dormant. Personally I wouldn't try forcing it

    Now I just need to come up with something to trade you for a piece when there is extra to go around!
    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

  3. #3

    Join Date
    Nov 2003
    Location
    Minnesota, USA
    Posts
    162
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    God... That is so cool. I hope you can propogate it, Tamlin. I just read an article about it in it's habitat. What an awesome plant.

  4. #4

    Join Date
    Feb 2003
    Posts
    181
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi William and others. I am happy to know your plants are growing well. Mine are also growing like crazy, two plants are blooming right now and I have tried cross pollination. Hope to get some seed for those i promised some.

    The only experience i have is that keeping the plants permanently wet will make it spread through the pot produceing small plants wit little or no tubers, and later you will end with nothing. I hope what you are going to try works better.

    I am even growing one plant as epiphytic along my plants of Restrepia (An orchid) in a piece of the branch it was growing when i found it and it is doing well. It gets completely dry sometimes but the plants dont suffer with the good air humidity inside the greenhouse.

    My hope is that we all discover the best method to grow this plant in the long term.

    I lost Peter's mail address, you have it William?

    Regards,

    Sebastian

  5. #5

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Unfortunately no! He replied to a PM on the UK Forum I made, and has not responded since. Maybe you could ping him through a post "Looking for ...." on the CP Listserve?

    Thanks for the good advice Seb. I don't want to sacrifice the plant by growing it too soft. Congratulations on the flowering, I hope you get some nice photos, and seed!

    Thanks as well for the faith. We are going to make this work!
    "Grow More, Share More"

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well like Tamlin I can also report great growth on all 3 of my plants, all of which have at least doubled in size. I have each in different media but all are in my crawlspace with the highland plants. I have taken the water every week or two approach so maybe I will have luck getting tuber formation with this method. I will also read up in Taylor on this and see if there is any clue there. I am sure between the group of us here in the U.S. and Seb and crew down South one of us will come up with the trick.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So is there a history of U. jamesoniana being difficult to grow? All the other epiphytes I've tried haven't been all that tough. I would advise against trying to "make" it do anything though.

    Here's a thought though: Taylor's notes say that it has been collected in flower in every month. This seems to indicate that it's growth isn't particularly seasonal, so perhaps the "tubers" (which aren't really tubers, of course - not root-derived, no starch etc.) are simply for water storage. In this case you could think of the tubers as organs adapted for survival of occasional dry periods.

    The comparison to U. geminiloba may not be entirely appropriate. The two plants are in different sections, and Taylor states that only some specimens of U. geminiloba that he examined had tubers (although he says that this may heve been due to careless collecting).

    Anyway, I don't have this plant, so I can only speculate on how it should be grown. If something's working for you, stay with it.

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Following on what Tim said. Straight out of Taylor

    U. jamesoniana grows on "mossy tree trunks and branches in montane cloud forests or lowland rain forests from near sea level to 2500m altitude."

    and

    "...from collectors notes and my own personal experience in Panama and Equador this species invariably grows on trees from 1m to 5m or more above ground level."

    From that I think Tim is correct in his assumption that the tubers are simply for water storage.

    And Tim, to answer your question on whether there is history of this plant being difficult, I don't think this plant was indroduced before the batches that have just got in to cultivation thanks to Seb (though I could be wrong on that.) Given the mad growth I am seeing I am going to say it is not difficult at all and may even be easier than alpina!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •