User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: Red dragon

  1. #1

    Join Date
    Jun 2003
    Location
    winchester va
    Posts
    332
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a red dragon and I am told that they are a bit finicky about the type of care they receive. I am wondering if anyone having one of these would through some tips my way if they require different growing condittions...thanks

  2. #2
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just moving to the VFT forum where it might get more response. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Poof!
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi mcrwt644,
    I don't treat mine any differently from the others....and it seems to be doing just fine. That said, I've only had it maybe a month or month and a half.
    Nice thing is it's eating well... [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'll second Schloaty. I don't treat my Red Dragons any different than my other VFTs and they are doing fine. I've had them since last fall.

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The only special treatment I have heard about is that to get the full colour for them you need to have them in dright light as much as possible, think all day in full sun.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Jul 2002
    Location
    Findlay, OH
    Posts
    1,181
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was also worried about my Red Dragons when I first purchased them. I had read several times that they were more difficult to grow and to keep long term.

    I received my plants during the winter months and put them under artificial lighting. My current lighting does not bring out the nice deep red coloration, and has left the plants looking more like Green Dragons. Since receiving the plants ( from pft ) they have flowered and did not show much stress from the flowering under the growing conditions I have them under. I now am enjoying some nice red venus flytrap seedlings.

    Please keep in mind that one should not let thier flytrap flower as it weakens the plant to the point of death or possible death. I believe the reason I had such good results was that I had fed the plant a nice beetle and cricket feast the month prior to flowering.

    Although not the color they should be, I find them easy to grow.
    Nick

    Careful where you crawl, it might be a trap!

    http://www.carnivorium.com
    http://www.buckeyecarnivores.com

  7. #7

    Join Date
    Sep 2001
    Location
    United Kingdom
    Posts
    2,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Some people find that Red Dragons can have problems with too much water. If you keep the water table lower then that seems to help.
    Alexis Vallance, U.K.
    Plant gallery
    Grow list

  8. #8
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'll water mine about 3/4 what I water my others (Like If I give the others a full tray of water I only give my red dragon 3/4 tray). When all the water runs out of the tars of my others then do I water my red-dragon (even if it has been dry for a while[up to a certain amount of time]). It seems to enjoy it. though it is green at the moment because the sun wont and cant shine through the fog and clouds. (that's the mountains of North Carolina for you LOL)

    Wes [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]
    ~Wes~

    My plants are going green to save the environment

    My Growlist

Page 1 of 2 12 LastLast

Similar Threads

  1. Replies: 15
    Last Post: 10-07-2008, 06:15 PM
  2. Red dragon
    By BobZ in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 2
    Last Post: 05-18-2004, 05:17 PM
  3. Red dragon
    By Lauderdale in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 9
    Last Post: 05-02-2004, 12:51 PM
  4. Green Dragon vs. Red Dragon
    By jimscott in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 7
    Last Post: 04-11-2004, 11:36 AM
  5. vft red dragon
    By cool85k5 in forum Carnivorous Plant Trading Post
    Replies: 4
    Last Post: 02-18-2004, 06:25 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •