User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 31

Thread: Akai ryu's leaves doing weird things...

  1. #17
    Jeremiah Harris's Avatar
    Join Date
    May 2002
    Location
    Colorado Springs
    Posts
    1,239
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I totally agree with BigCarnivourKid
    I let mine VFTs sit in in of water at all times
    I repot mine a lot with great results
    give them as much light a possible

  2. #18
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have transplanted VFTs, I top water, my VFTs sit in saucers with 1/4-1/2 inch of water, they are potted in peat/sand/perlite mix, they eat lustily outdoors in the warm sunshine...and they all do just fine. Watering is no complicated process. I watch the soil moisture and water when needed...and thats only when rain doesnt take care of it.

    Just my 2 cents. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Suzanne

    And just a thank you to the Mother for blessing us with so much rain, snow, sleet and ice to get us through the extreme drought we've had for the last 2 yrs
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  3. #19
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Amen to that Suzanne [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] , We can use all the wet stuff we can get here in the mountains too.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  4. #20

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I use the tray meathoid. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    There's a tunnel at the end of the light...

  5. #21
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Gotta add my 2 cents, too.
    I have mine on the tray method for the summer.

    I used Darcie's method for my VFTs durring their dormancy. Seems like it worked. Keeps the soil just moist.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #22

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (schloaty @ Feb. 28 2003,9:45)
    Gotta add my 2 cents, too.
    I have mine on the tray method for the summer.

    I used Darcie's method for my VFTs durring their dormancy. Seems like it worked. Keeps the soil just moist.[/QUOTE]
    Thanks. Glad it worked....

    And I keep my plant in about 1/2cm water during the summer letting is dry slightly weekly. I'm sure their are many ways that work, mine is just the cautious meathoid, and of corse, red dragons always need a little extra care. Oh yah, and I don't use fungiside, so it's more importent to regulate conditions [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] (If I were to get any more nerotic about my plants I'd have to put in moisture gadges, and I do have personal resons for dislikeing blanket tray meathoids. I lost my first two plants that way and was only told after their death about how the pots need to dry off a little and how stagnent water is bad(specially if you have no live sphagnum))

    I just try to give the most compleat growing instructions possible without barking at people to go buy lights to shine on their plant (something that is a pain and not everyone will want to do). And of corse, in this proticular thred, I was addressing a plant showing the classic "I can't take the water" symptoms, in addition to that, we are talking about a red dragon, a plant that requires much much more light to handle the same amount of water as other plants without dieing, but a typical plant will grow well in the dragons conditions too, which is why I figure, if you have to do it for a week plant, you should be doing it for a strong plant, lol [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Oh yah, and I also am a big fan of using live sphagnum as a conditions indicator. Chances are, if it is happy, so is the VFT. My sphagnum usually spoors once every week or two and each strand grows about 1 inch per year after it's origenal growth spurt of about 1 inch in 2 months (only counting long lived fleshy part, not the short term reproductive organs). From what I have heard, thats fairly good, right? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] hee hee, I remember my first sprig bit fondly. It was stuck next to the vft for the heck of it by the grower (asked in an e-mail). I was actually more worried about killing my sprout then the vft, lol. Then one day it made a spoor head and when it dried and dabbed it againced the soil in hopes of babies. I was so excited when they came, by the next year they had taken over the pot. Now, I collect the spoor head for other pots and the little 1inch green heads conseal a tangle of dead peat being made. Sorry, I got nestelgic their.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  7. #23

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Jeremiah @ Feb. 28 2003,09:41)
    I totally agree with BigCarnivourKid
    I let mine VFTs sit in in of water at all times
    I repot mine a lot with great results
    give them as much light a possible[/QUOTE]
    Oh, yah, repotting isn't an issue for me either, I just don't recomend it in case the plant does take a turn for the worse, because if your new to the plants, you won't know how to pull it back from the brink [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] Their not like cape sundew where you can pull the roots to shreds and have them survive.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Darcie @ Feb. 28 2003,11:46)
    And of corse, in this proticular thred, I was addressing a plant showing the classic "I can't take the water" symptoms, in addition to that, we are talking about a red dragon, a plant that requires much much more light to handle the same amount of water as other plants without dieing, but a typical plant will grow well in the dragons conditions too, which is why I figure, if you have to do it for a week plant, you should be doing it for a strong plant, lol [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img][/QUOTE]
    Darcie,

    I am going to have to disagree with almost everything you have said here. All VFTs are capable of taking conditions from submerged to just damp and none will try to "escape" these conditions as it is what they evolved to grow in. A plant can not make a consious decision to not like the amount of water it is exposed to and "lift" itself away. If a plant gets too much water it has 2 choices: tough it out or rot and die. As far as special conditions, the 'Akai Red' VFT does not need any treatment different from a typical VFT, I have my 'Akai' in a window box with a type, 'Dentate' and 'Green Dragon' and all are thriving. If you want it to be red then you need to give it good light but it does not require the light to grow like a normal plant. If grown under lower light conditions all you get is a well grown 'Akai Red' that just stays green. It does not need to be kept drier, I know the guy who created the 'Akai Red' and he has one that he has grow submerged for 2 seasons and it is a monster.

    I believe that BCK hit the nail on the head when he said it was likely that soil had just been washed away from the bulb of the plant. This happens all the time when top watering until the soil compacts to normal levels.

    Back to the original topic at hand, My plant did something similar with the whole colour change thing. I never was able to figure out why but towards the end of last season and now with new growth I am not seeing it. So maybe it is just an artifact of transplant and establishment. Or maybe there are some trace minerals in the soil that have not fully flushed and these are having an effect.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

    Page 3 of 4 FirstFirst 1234 LastLast

    Similar Threads

    1. Dogs Dig Up Weird Things
      By NeciFiX in forum General Discussions
      Replies: 16
      Last Post: 07-27-2007, 06:01 PM
    2. Weird things while transplanting...
      By Andenes in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 10
      Last Post: 06-06-2005, 07:28 AM
    3. Weird things
      By turner in forum Venus Flytrap (Dionaea ) Care Information & Tips
      Replies: 12
      Last Post: 01-01-2005, 04:06 PM
    4. Weird leaves?
      By dfalkanger in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 1
      Last Post: 09-09-2002, 08:17 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •