User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Dente, dentate, dentate traps, etc

  1. #1
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So far I have found photos of VFT with dentate traps having 5 different names (3 registered cultivars and 2 unregistered).
    http://www.humboldt.edu/~rrz7001/Dionaea.html
    'Dentate' (D'Amato)
    'Dentate Traps' (B.Meyers-Rice)
    'Dente' (D'Amato)
    "DentateTrap X11 form"
    "Dentata"

    It would be very interesting to compare these plants side-by-side under the same growing conditions.

  2. #2
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    OOPS.
    Moderator, would you move this to the VFT section?

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Moving [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very interesting Bob. The X11 form seems to be a selected clone that they pulled out of TC, looks like it's a 'Dentate Traps' form.

    'Dentate' and 'Dente' I believe are two names for the same form. Which were both tissue culture mutations, maybe of 'Dente'?

    And as far as 'Dente', the description seems to elude that this started out as a wild plant then when through TC, not just a mutation that came from it.

    'Dentata'...that picture's ciliate margins show a similarity to 'Saw Tooth'...I wonder if someone just misspelled it.

    So, as far as I can figure so far, it started with 'Dente', two mutations in TC were name 'Dentate' and 'Dentate Traps', 'Dentata' may be a misspelling or missidentified, and the 'X11' is just a specific TC clone that they liked more than the others.

    Just my opinions so far though, will do more research on it. Hope any of this helped.
    Lithops care info: If you take care of it, it will die.

  5. #5

    Join Date
    Sep 2001
    Location
    United Kingdom
    Posts
    2,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think the original Shark's Tooth clone was 'dentate' and this was shortened to 'dente' later on. Dentata is the German version of Sawtooth, but I don't know if they are the exact same plant. Shark's Tooth Dentate is an Australian version of dente and this has a much more erect growing fashion than the American versions.
    That's what I understand anyway, although someone might know more.
    Alexis Vallance, U.K.
    Plant gallery
    Grow list

  6. #6

    Join Date
    Sep 2001
    Location
    California
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Barry Meyers-Rice looked at "Dentate" and "Dente" and did not notice any differences. He consolidated the two into D. 'Dentate Traps'.

  7. #7
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    To obtain a more definitive answer, I contacted Dr. Barry Rice with the following question:

    There is a note in the CP Database for both 'Dente' and 'Dentate': "HC: the established name for the same cultivar is [Dionaea 'Dentate Traps' {B.Meyers-Rice}]". It also says 'Dentate Traps' was wild-collected, while 'Dente' and 'Dentate' are TC mutations. Does this mean that 'Dentate Traps' takes precedence over 'Dente' and 'Dentate', even though 'Dentate Traps' was published in CPN and registered in 2000, while 'Dente' and 'Dentate' were described and published in 1998 in Savage Garden (but not officially registered as cultivars?)? Are all three the same plant? There are also several other names floating around without official descriptions, such as "DentateTrap X11 form" and "Dentata".

    Following is Barry's response (with permission):

    "The official and correct name for all these cultivars is 'Dentate Traps'. I wrote the cultivar description to be broad enough to include them all under this nomenclature. The other plants may or may not be clonally identical."

    "So the dentate traps term refers to any VFT of any origin that fits the broad description as I wrote it up. Mind you, if someone has a SPECIFIC clone they think is extra-special-double-plus-good, there is nothing stopping them from establishing this selection as a new cultivar. They just have to write up the distinguishing features that set it apart
    from the crowd, etc etc."

    "The key here is that the cultivar code and registration is a helpful tool, and not an obstruction or source of confusion."

    "Incidentally, I would have rather used the name already in use, for my cultivar description; this would have established the cultivar name Dionaea 'Dentate'. However, the cultivar code says you cannot use purely adjectival names for cultivars (with a few exceptions) because it might be that the leaves, petals, stems, etc were "dentate". So I added "traps" to the name."

Similar Threads

  1. dente vs dentate
    By thbjr in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 4
    Last Post: 03-13-2008, 08:36 PM
  2. Dentate flowers :3
    By SirKristoff in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 13
    Last Post: 01-22-2008, 08:33 AM
  3. my dentate traps
    By SirKristoff in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 7
    Last Post: 12-31-2007, 01:01 PM
  4. new Dentate traps (Huge leaves on this one)
    By SirKristoff in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 2
    Last Post: 12-13-2007, 03:43 AM
  5. Dentate and dente?
    By peter in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 8
    Last Post: 06-10-2004, 05:53 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •