User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: 'denate trap'

  1. #1

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,

    I'll have a picture soon, but I noticed that a trap on my akai ryu vft that's about to open has jagged, triangular short teeth like a dente vft. Why is this? (no, its not red pirahna but its starting to look like one) [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    thanks

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My guesses would be:

    1) Spontanious mutation on that leaf

    2) Mislabled plant
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I forgot to mention... it also has other traps that are normal.

  4. #4

    Join Date
    Jul 2002
    Posts
    482
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My guess is low humidity.
    VFT's to offer here===>http://www.phongvft.org

  5. #5

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sometime new traps look dente before they open all the way because the hairs are still curled up.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  6. #6

    Join Date
    Oct 2003
    Posts
    1,211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I've had that happen before. I'd second pyros first guess. In fact,during dormancy, the plant produced something like a cup trap!
    1 Nxventrata

    D. muscipula & D. muscipula 'Red Dragon'(barely)

    Sarracenia leucophylla(seedling)

    S. purpurea and Drosera filiformis filiformis/ intermedia seeds waiting to sprout.

    Drosera capensis

  7. #7

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i had this happen with one of my typicals, but as soon as i got it into better conditions, more light mainly, it started to grow regular traps again. Maybe its some kind of a stress response.

    Ktulu
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  8. #8
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If you got that plant from the LACPS meeting from Ed Read then its most likely a red pirhana that was mistaken for a red dragon during TC .

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •