User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 9 FirstFirst 1234567 ... LastLast
Results 17 to 24 of 68

Thread: Giant fly traps

  1. #17

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How bout a nep with a butterwort, :
    nepenthes bicarlarata X pinguicula primuliflora I've just invented that! At least in my dreams - That's crazy! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Tamlin, depends, better at what? Fooling around I see is common round here... [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]

  2. #18

    Join Date
    May 2004
    Posts
    29
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    test
    Last edited by The 92nd Fish; 11-19-2014 at 05:52 PM.

  3. #19

    Join Date
    Apr 2004
    Location
    Devon, UK
    Posts
    39
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Jason Wong @ May 29 2004,10:44)]How bout a nep with a butterwort, :
    nepenthes bicarlarata X pinguicula primuliflora I've just invented that! At least in my dreams - That's crazy! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Tamlin, depends, better at what? Fooling around I see is common round here... [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    Wouldn't the prey stick to the sides of the pitcher before it sploshed into the juices in the bottom? [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    \"Feed me, Stevie! Feed me all night long!\"

    I don't know
    I don't know
    I have so, so many strong reservations
    Should I go and perform mutilations?

  4. #20
    Flip_Side_the_Pint's Avatar
    Join Date
    Dec 2003
    Location
    Lartnec Yellav, Ca
    Posts
    1,433
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    the pitchers wouldn't be sticky inside. The leaves the pitcher is attached to would be sticky... The whould plant would be a giant trap.... awesome....
    https://www.instagram.com/hull.jess/ (I post pics of my plants there)

  5. #21
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (BobZ @ May 28 2004,4:59)]
    Quote Originally Posted by [b
    Quote[/b] ]He dropped out of contact about 1980 and no one has heard from him since.
    I remember him. His name was Seymour Krelborn.
    His plant is seen at
    http://www.********************.com/photos/audrey.jpg
    Audrey 2! Suddenly Seymour...

    Hey, I thought I was doing pretty good with 1" traps.

  6. #22

    Join Date
    Jun 2004
    Location
    Richmond, ca
    Posts
    221
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    what was that old movie with the huge plant that eats ppl , takes place in new york i think, with the guy from, honey i shrunk the kids![U] that movie was great
    Fly eats dung,plants eat fly, dog eats plant, asian eats dog
    [img]http://home.**********.com/users/aznsushi41/Feeding/Fed%20Fly.jpg[/img]

  7. #23
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a friend who is treating VFTs in culture with colchasine. So far it is too early to tell but maybe one of them will be a supersize mutant
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #24

    Join Date
    Mar 2004
    Posts
    49
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Tamlin Dawnstar @ May 28 2004,4:17)]There was a master breeder back in the 70's working on creating some super sized VFT's using gamma radiation and gene splicing. He got a reportedly HUGE all green form that he was feeding rats to. He was keeping it all hush hush. He dropped out of contact about 1980 and no one has heard from him since.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img] SURE HE DID [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]

Page 3 of 9 FirstFirst 1234567 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •