User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 10 of 10

Thread: Do we need this: Glowing Cats

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mokele covered it, you want to track aberrant expression of a disease gene then pop the tag on it and look for it. And since cats and humans share a number of genes you can look at those shared genes that have similar disease traits.

    What boggled me about it is that they went and did it in cats when we have had it in non-human primates for at least 4 years. Sort of seems a step back to me.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Whaaaaat the [bleep].
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •