User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 27 of 29 FirstFirst ... 1723242526272829 LastLast
Results 209 to 216 of 231

Thread: Ron Paul 2008 Revolution

  1. #209
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Outsiders71 View Post
    I don't honestly believe this story you told.
    May I point out that just because you do not believe it does not make it true. The beliefs of any single person or group of people do not change what actually is

    Papers can be faked. If anything a mock-wedding was probably given along with mock papers to appease the mentally disabled man.
    The papers are not faked, as I said I have seen them. But you do not believe that so...

    You're the only one arguing for being married to a piece of plastic, I never said anything about it, in fact I laughed because that's the most bogus thing I've ever heard.
    No I am not arguing for it. I am arguing that if it is legitimate for there to be a union of flesh and blood person to a piece of plastic then any union between two flesh and blood people should be legitimate.

    I admit that you fail at comprehension
    By admitting that I placed you under that umbrella I was 1) admitting to my own personal bias and 2) offering an invitation to change my mind. I am so grateful that you instead took it instead as an opportunity to deal out a personal insult. That was very adult of you

    please re-read my last post.
    Right back at you.

    Actually scratch that. I'll reword it here since it seems I was too unclear.

    When I say someone is against same sex relationships I mean that they do not approve. To not approve is merely an opinion.

    "Hate" on the other hand is a much more intense thing. Something deeply felt on a mental/psychological/emotional level.

    So, based on your numerous posts, where you speak your mind rather openly, it comes off to me that you do not approve of (and therefore are against) same sex relationships. If I am wrong on that then so be it I will gladly admit it. But you are going to have to prove to me that I am wrong in some way other than sniping at me and insulting me.

    It really isn't surprising however since you believe there's a man who has a legit marriage to a doll. How naive can we be?
    You are only as naive as you chose to be. As I said above so I say again, The universe is not obliged to change what is just because you do not believe in something.

    What kind of ignorance is it when I tell you I have no problems with same-sex relationships, and then you turn around and claim that I do?
    As I said above, your numerous, very vocal posts give me the impression that you do not approve of same sex relationships. That is not "ignorance" that is just how you come off.


    And I am going to close (and stay gone) after this little tidbit. Since you are so into the definition for what constitutes marriage let me ask this. Aside from the Man + Woman that you stand by what exactly is the difference between a "marriage" and a "civil union"? They are both viewed the same by the taxman and the benefits groups and the census bureau and all that jazz yes? So, if it walks like a duck and talks like a duck and acts like a duck they why on Earth should we call it a chicken?? Regardless of whether they are mallards or pintails they are still ducks. Regardless of whether they are heterosexual or homosexual they are still committed couples who want to be recognized as being together.

    That is all for me. I shan't be back to this thread.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #210
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, there was no "first" koala. It was a kolaesque animal that ate probably many things, but later specialized and found it's niche and evolved to only eat eucalyptus. It's like "Which came first, the chicken or the egg?" Neither. A reptilian protochicken that laid eggs came first!


    The horror.

  3. #211
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    on the koala thing...........time...........over time humans can adapt to snake venom.....why cant over lots of time an animals body learn to cope with cyanide?
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #212
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by JustLikeAPill View Post
    Well, there was no "first" koala. It was a kolaesque animal that ate probably many things, but later specialized and found it's niche and evolved to only eat eucalyptus. It's like "Which came first, the chicken or the egg?" Neither. A reptilian protochicken that laid eggs came first!


    The horror.
    Exactly. One of these "kolaesque animal" mutated some gene that allowed them to eat eucalyptus leaves, diversifying their ability to eat and allowing them to eat more foods, thus allowing them more opportunities to survive and reproduce and spread this gene. Who knows, maybe eucalyptus leaves could have been in a safer environment thus further assisting this evolutionary growth and development.

    It's the same with animals that are immune to snake venom, as I think rattler suggested. These animals weren't always this way, but thanks to one animal having a mutated gene they "adapted" and were able to better survive.

    It was also a good point anout carnivorous plants. That example goes without saying...

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  5. #213
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Nepenthes View Post
    1. I fully agree with Capslock, Justlikeapill, and Phissionkorps. Look at their arguments and rebuttals, and it is clear that they just plain make sense.
    Of course you're going to join the bandwagon.

    Quote Originally Posted by Nepenthes View Post
    3. Gay Marriage: To Outsiders: If you truly don't have any qualms with the union of a gay couple, then why does the name bother you so much?
    Do you think gays/lesbians would have qualms if I started calling them straight or heterosexuals? They aren't straight or heterosexuals and want to be known that they are in fact gay or homosexuals and they are proud of it. So why would it be appropriate to give the name of a union that has ALWAYS belonged to heterosexual couples to homosexuals or anyone else who isn't heterosexual (ex: dolls, animals or invisible people)? It would be like categorizing a new rap artist's music as classical and placing it with Beethoven.

    Quote Originally Posted by Nepenthes View Post
    If you really think they should have the same rights, then why can't they call themselves married?
    Once again, and this has been repeated several times...Why is it necessary to call a gay union a marriage to have the same legal rights? It isn't necessary.

    Quote Originally Posted by Nepenthes View Post
    You said that they should be given equal treatment, but then you say that they should be differentiated by name. To support this you cite the traditional definition of 'marriage' in history. Isn't one of our greatest qualities as humans our ability to adapt?
    Please give me a legal example of how the difference in a term would disenfranchise a gay union if it said in the law that they had the same legal rights as a marriage. Would you 'adapt' and place Beethoven in the R&B section of a music store?

    Quote Originally Posted by Nepenthes View Post
    Sure, from a legal, or religious, standpoint marriage may have been interpreted as a union between a man and a woman, but the reality is that gay couples have been around forever.
    Yes but marriage has always been an institution between a man and a woman, there never has been any other interpretation which is why it is ridiculous to say we need to change it. It doesn't need to be changed, instead Gays deserve their own term for their unions.

    Quote Originally Posted by Nepenthes View Post
    Why should they not be afforded the same comfort of a proper name? It is hard for me to understand how the sharing of a name can move you so deeply as to necessitate your vociferous oppostion (in light of your alleged 'tolerance').
    What comfort would the title marriage bring to gays? You do realize that not all of the gay community wants to be called a gay marriage right? There are gays out there that aren't ashamed of their lifestyle and do not want to be lumped as a marriage because they clearly understand there's a difference and are proud of it.

    Quote Originally Posted by Nepenthes View Post
    4. Religion: I barely even want to touch this topic... I've already had a few words with Outsiders about it before but... I have a few basic problems with religions in general, and some of them are as follows: A. The bible was written by man, not God. B. There is zero, and I do mean zero, proof of the existence of God. C. The Old Testament, shared by heavy contenders of religion: Judaism, Islam, and Christianity to name a few, is riddled with what can best be described as fairy tales and mythical creatures and events. D. Religion has caused more death and suffering than all other disputes, ever.
    A. Did you witness the creation of the Bible? Did God personally tell you this? If you accept the notion that there is a God, who created everything mind you, why would it be impossible for Him to communicate through a vessel (man) and assist with the Bible? If you ever do get a chance to read the Bible and still hold this thought that it was just man derived think about this. What is the message of the Bible? Why would man write something that is so counter to the way the world is as we know it. Standards so high that God Himself had to come down in human flesh and live the perfect life to make atonement because no one could live the Holy life God calls us to live. How many God's do you know of that love you unconditionally, even when you're His enemy? How many God's do you know of that would gladly take the wrath and punishment we deserve for our sin and wickedness upon Himself, when He was perfect and without fault? If man truly wrote the Bible, women would be sex objects for men's disposal. If man truly wrote the Bible, God would have told us the opposite of the 10 commandments. If man truly wrote the Bible, God would have told us to care about ourselves and screw everyone else. I wonder how many people actually sat down and studied the Bible with an open mind and came to the same conclusion you have. Instead people would rather learn what the Bible is by people who've never read it or understand it or can comprehend it.

    Quote Originally Posted by Nepenthes View Post
    I do like some aspects of religion though... I do like that many of them instill respect, kindness, and altruism among their followers. I don't like the fact that many also believe you will suffer if you do not ascribe to their beliefs though.
    The last thing we need is another religious person to damn everyone to hell. If you care about God, seek a relationship with God. I think accepting God's grace is very minor to what we truly deserve. Seriously have you ever sat down and analyzed your life? Sure some of us try to live a life of goodness but how good is it in reality? I bet if we're honest we can all admit we all fall short of what is truly righteous.

    Quote Originally Posted by Nepenthes View Post
    5. Evolution: Really? I mean really? How is this even disputed? This is a freaking carnivorous plant discussion forum. Is there one type of nepenthes? Is there one human race? Insects change, plants change, animals change, and humans change. It's a very simple FACT.
    The problem here is the FACT that evolution is a THEORY. As I said earlier yes populations can change and listed examples such as MRSA that's immune to antibiotics. However the major issue with the theory of evolution is that people try to apply it as the source for the origin of life. That everything you see today on the Earth evolved from a one-celled thing in the ocean billions of years ago by randomness.

    Quote Originally Posted by Nepenthes View Post
    Sure God may exist in one form or another, but I can gurantee that no religion known to man encompasses the truth of the matter.
    God does not tell us the exact process of how we were created. What He does tell us is that He created us, that it wasn't from randomness and that everything you see on the Earth today didn't evolve from one common ancestor. Instead God tells us that first He created the Earth and then created the vegetation, the living things in the water, air and land. Then finally He specifically says He created man and then woman. Does this mean that all these creations couldn't have evolved in some way to deal with the conditions of the Earth since their creation, no. It just clearly states that we are not a product of monkeys. Humans share 50% of the same DNA as a banana, and 60% of the same DNA as a fruit fly. Does it make more sense that we share a common ancestor to those two or that a creator used the same building materials to make all the life on Earth? It's not a question that you need to answer on here and I know people will still choose to believe they are a random mistake from the ocean billions of years ago and that's fine. It's your choice to put faith in that.
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

  6. #214
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by JustLikeAPill View Post
    Well, there was no "first" koala. It was a kolaesque animal that ate probably many things, but later specialized and found it's niche and evolved to only eat eucalyptus. It's like "Which came first, the chicken or the egg?" Neither. A reptilian protochicken that laid eggs came first!


    The horror.
    From what I understand the closest relative to a Koala is a Wombat and they can't and don't eat Eucalyptus. Lastly it's populations that evolve, not individuals.
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

  7. #215
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by rattler_mt View Post
    on the koala thing...........time...........over time humans can adapt to snake venom.....why cant over lots of time an animals body learn to cope with cyanide?
    Adapting to snake venom and having a specialized digestive system that can handle Eucalyptus are two different things.

    If it were fictionally possible to give you 1,000,000,000,000,000 lifetimes and in each lifetime we gave you cyanide, do you think you would evolve an adaption?
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

  8. #216
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by xvart View Post
    Exactly. One of these "kolaesque animal" mutated some gene that allowed them to eat eucalyptus leaves, diversifying their ability to eat and allowing them to eat more foods, thus allowing them more opportunities to survive and reproduce and spread this gene.
    Koalas don't have a mutated gene, they have a specialized digestive system that allows them to handle Eucalyptus leaves. The time it would take for their digestive systems to evolve to handle the cyanide would be too long and they would die from the cyanide. This is not a simple gene mutation.
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •