Ahhhhhhhhhhhhh, a new member who is interested in Drosera species! Welcome to the forums!
Ahhhhhhhhhhhhh, a new member who is interested in Drosera species! Welcome to the forums!
"Grow More, Share More"
Hi and welcome Darcie !!
You will find all the informations about sundew and others beautiful and amazing carnivorous plants in these forums.
So have a good coltivation starting with the easy species and then go on with the more difficult one.
Kind regards
rajah
Quote Ahhhhhhhhhhhhh, a new member who is interested in Drosera species![/QUOTE]
Tamlin, I can hear you licking you chops all the way over here!!![]()
![]()
Darcie, welcome!
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
09-20-2002, 07:35 AM #12N=R* fs fp ne fl fi fc L![]()
![]()
- Join Date
- Aug 2001
- Location
- Maryland
- Posts
- 4,844
- Mentioned
- 0 Post(s)
- Tagged
- 0 Thread(s)
Darcie,
Welcome
And since my name was mentioned I can not help but pip myself a little. I might not come close to Tamlin in Drosera knowledge but I have a bit and some plants too so feel free to drop me a line any time. And if you like Utrics too, so much the better
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
09-20-2002, 10:34 AM #13![]()
- Join Date
- Mar 2002
- Posts
- 1,866
- Mentioned
- 0 Post(s)
- Tagged
- 0 Thread(s)
Welcome to the forums! There are alot of great people around here. You will be sucked in to the world of CP's - and for everything else there is MasterCard!
travis
\"Some cause happiness wherever they go; others, whenever they go.\"
-- Oscar Wilde
http://www.nasarracenia.org/
Tags for this Thread