I think its U.unifolia.
I think its U.unifolia.
CP2k and Tristan get the prize (now I just have to figure out what the prize is LOL![]()
)
It is indeed U. unifolia.
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
And that is what we would all kill for. hmm......neat I guess not much of a Utricularia fan but I do like Quelchii,Reinformis and Alpina.
Nepenthes - hail to royalty
http://www.terraforums.com/forums/sh...ad.php?t=96246
You're a lucky so-and-so, you know that, right?![]()
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
Pyro,
you have to post a picture (when it flowers). ;-)
And I have to wait some days until I'm at home again to have a look at my "Taylor".
Martin
I travelled 10 weeks through Ecuador rain forest (and other South and middle-American countries) three years ago but couldn't find any CPs.
But I didn't really search for them...
Martin
my homepage : http://www.drosophyllum.com
I'm with Nep G., not too big on Utrics![]()
I'd rather kill for a nep![]()
Well you all might not fint it that impressive but to Utriphiles it is a holy grail type plant (IMHO)
Martin,
Once it gets going again I will post out some pics and when it flowers I will probably break my camera through too much use![]()
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
So Pyro doesn't have a Pom pom, but does anyhow here? I would love to get that plant, it's so cool, but I've only seen photoes and sketches
There is no item greater in value than life, for without life value would cease to exist.
My Grow List