User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 6 of 6 FirstFirst ... 23456
Results 41 to 45 of 45

Thread: The plant gods play games

  1. #41

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I wouldn't kill for it, but I sure would consider theft or gratuitous sex.
    "Grow More, Share More"

  2. #42

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nah, on second though, I'd pobably just kill it.
    "Grow More, Share More"

  3. #43
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Congrats Pyro! hope it grows well for you!

    -noah

  4. #44
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mental note: Install security system before Tamlin sneaks down from NY and kills me






    J/K
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #45
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Tamlin,
    Your second option doesn't really require a plant....


    Sheesh, I'm already talking like a maried guy...
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 6 of 6 FirstFirst ... 23456

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •