It has been a grand year with you here. And I anticipate many many more
It has been a grand year with you here. And I anticipate many many more
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hi Tamilin,
I know I haven't known you long,(or anyone else) but you have truly helped me (and everyone else) ALOT with growing my plants!!!
AND I have seen you give literally(sp?) hundreds apon hundreds of plants/seeds away! I am definatly(sp) a member of the Tamilin club!(not because you give away plants! )
Congrats Tamlin!! You're the best! Your wisdom and humor keep all of us on track. I raise my glass to you also. Cheers!
*
* *
xxxxxxxxxxxx
xxxxxxxxx
xxxxxx
xxxx
xx
x
x
x
xxxxx
![]()
The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!
Hey Tamlin,
1000 posts...wow....That's 1000 bits of info that keeps other people (well, me) from killing their plants...Thanks (my plants definately thank you too)!
Cheers!
<< CHUG >>
...
wait..I mean << sip >>....yeah, that's the ticket.![]()
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
continue same way Tamlin!![]()
I haven`t been here long time but that time whose I have been here doesn´t really gone in wain.![]()
Glad to have met you. I appreciate your encouragement.
Hope we keep on living our lives for these jewels of the plant world for a long time to come. . .
Joseph Clemens
Tucson, Arizona, U S A
Happy Anniversary Tamlin
Always willing to share your knowledge, experience and CPs with novices and experts alike. You are a 5 star asset to PFT forums, I'm glad I've met you here too.
Keep up your good work.
Cheers
Vic
They say that money talks, but all it ever says to me is goodbye.
Yippee.... who's treating for dinner?![]()
Congrats Tamlin!![]()
DOH!