x'Sticky Fingers' [/QUOTE]
I am guessing that has a tint of Martial Arts in that name.
Travis
Travis LOL!
Didn't even think of that, actually. Embarrased to say it came from Home Alone 2....the sticky fingers bandits....you know, where the doofy burgler had tape or glue or something on his hand as was stealing hats off peoples' heads.
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
LOL. I am like wow that is a good name. Makes sence, dew is the sticky part and the trap is the hand heheheha. Hey, Home Alone 2 was good for something. 
Travis
SirKristoff is a poopiehead
Darcie, I'm sorry to say that almost everything you said went right over my head. Most of it, I don't have a clue to what you meant. I'm not knocking you, I'm just saying I don't unerstand it. I don't know very much about genitics.
Like Goldtrap said this has been done, and failed every time. the seeds sprouted then died. Vft's and sundews both come from the same famliy Droseraceae.
Quote | It's also a rare event for the events to coincide, but it DOES happen in nature![/QUOTE]
I'm sure that vft's and sundew have crossed in nature since the vft's grow along side many different sundews. I'm also sure that the result was very similar to all the experiments so far. Either seeds that didn't sprout or plantlets that died soon after they sprouted.
Keep trying you never know what you'll get.
I believe if you get it to work it would produce a plant with,a vft type trap that reacts slower,the fingers on the trap would have dew,it might have dew on the inside of the trap,it would probably be realy weird looking,and it should be called xDiosera darcieanea Or somethin` like that.
Oh,and the reason I think the fingers would have dew is that they are most likely tenticals that have just adapted to not have dew any more as it was no longer needed. Has any body tried crossing D.californica and S.psticiana?
if the seeds sprouted means it can happen if you can keep it alive so why dont you do something about it?try out what environments and etc, and maybe make a special kind of "fertilizer"to keep it alive and those kinds of stuff...
ill try doing it if i was as smart as you and if i had free time and a lab(with workers)
good luck!
A lady went into a grocery store and looked into the turket section. She needed a bigger one for her family, so she asks the stock boy: \"Do these turkeys get any bigger?\"
The stock boy replied: \"No ma'am, they're dead\"
Msn/email - wezx1@hotmail.com
N=R* fs fp ne fl fi fc L
As I am working on my PhD in genetics this is an interesting read for me. First off, yes someone has tried making a VFT x Drosera cross-- VFT x D. regia to be precise. This is probably the only way the cross would work because it is the only Drosera even close enough genetically to the VFT. All the attempts (there have been a few) have produced either seed that failed to germinate or the few sprouts that were had all died before it could be determined if they were hybrids or just weak self-crossed D. regia. From what I have read the VFT has to be the pollen plant as the reverse cross has never produced anything.
To successfully get a hybrid plant from these genera I am guessing that you are going to need to do it in vitro and even then I am guessing that the odds are not that good. Granted polyploidy can occasionally generate a viable offspring the failure rate is very high and even the success stories still have something wrong with them in the long (or short) run.
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Tags for this Thread
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|
|