Best wishes. I thought you were going to announce quadruplets, with a heading like that (herd?)
![]()
Best wishes. I thought you were going to announce quadruplets, with a heading like that (herd?)
![]()
Heres to Andrew Jr., future CP enthusiast and car afficianado. Congratulations to all three of you!
"Grow More, Share More"
Bravo! Congratulations! That's really exciting!![]()
![]()
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
Grats...![]()
There's a tunnel at the end of the light...
A word of abvice from the father of a 7 week old: Start catching up on your sleep now because you won't get more than 4-5 hours a night in a few months
Congratulations and enjoy the adventure
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Congratulations!! Catch up on your sleep and enjoy your sanity nowThey are a joy and wonder.
I am just like a Super Hero, but without the power or motivation.................and the funky suit.
Quote (Copper @ Oct. 20 2003,10:40) ...................enjoy your sanity now [/QUOTE]
Most definitely. Remeber insanity is inherited! You get it from your kids![]()
!
10-20-2003, 03:08 PM #16Admin- I'm growing CPs in the Desert of Tucson, Az.![]()
![]()
- Join Date
- Jul 2001
- Location
- Tucson, Arizona USA
- Posts
- 8,611
- Mentioned
- 6 Post(s)
- Tagged
- 1 Thread(s)
Thanks all for the kind words!!
Casper: LOL! that's a great (but sad) story. Thanks for sharing it!
Plant a kiss: Travis was a smart man turning down Bicalcarata, I also will turn my nose up at it. The name is basicaly in stone. A little later on in the pregnancy I should have permission to tell it. lol. only becuase we are not 100% sure about it yet.
I think it would be cool to have him on feb 29th. I look at it this way. If the 28th is a thur and the 1st is a friday, where do you think the b-day will be? huh? huhyeah, you wish you had a leap year b-day huh? LMAO.
D muscipula: heard. as we all know by now the topic cannot be corrected. I do spell check the messages I submit but not usally the topic. It wouldn't had picked it up any way as you have pointed out what a herd is. LOL.
Tamlin: Andrew Jr. uhm yeah. lets not ok?but future CP enthusiast and car afficianado absolutley!! (you forgot chick checker outer... hahaha!
I do trust you all in the lack of sleep thing. But it shouldn't be too bad since I already only get about 5-6 hrs a night. (ecen on the weekends...WHAT IS MY PROBLEM?? ) hahaha
lol @ BCK
Andrew-Andrew
Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
Support FlyTrapShop, support TerraForums! www.flytrapshop.com
Tags for this Thread