User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 4 FirstFirst 1234
Results 25 to 29 of 29

Thread: Where does everyone stand in regards to...

  1. #25
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Finch @ Jan. 26 2005,5:14)]its (small pox) virtually extinct in the common populace
    key word, virtually. yah never know where some of this may be hiding in the natural world. the bubonic plague is actually still rather common in third world countries, yah can even find it here in the states if yah know where to look and it wiped out a significant percentage of the worlds population at one point.

    personally ill keep getting my flu shots, not because the flu scares me but the high likely hood of ME developing serious pnuemonia does. im also a firm believer in "exercizing" my immune system. i spend LOTS of time in the outdoors hiking, swimming in lakes and streams, camping and all that good stuff. i rarely take antibiotics as usually when i do get sick its a mild form of the common cold or flu. a super strain will show up. its not a matter of if but when.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #26

    Join Date
    Aug 2003
    Location
    Budd Lake, NJ
    Posts
    409
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Pyro @ Jan. 25 2005,10:13)]With doubling times on the order of 20 minutes at 37C (that is body temp [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] ) you go through a couple million generations a day with bacterial.
    While you are correct about quickly developing resistant strains, you're million generation a day is wrong. I calculate 72 generations in a single day with an ideal 20 minute replication time. Unless you meant millions of replications, then you would be correct.

    I'm sure it was a typo on your part, I just didn't want to freak people out.

  3. #27
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This reminds me of Lewis Black's bit on flu shots.. "Of course you don't get the flu when you get a flu shot, because you always have a COLD!! Every year, it's the worst flu season ever, it's coming! There's a guy over in France, he doesn't wipe himself properly.. HE'S COMING!!!!"
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  4. #28
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    j, I think you might also want to take into acount your not talking about one single strain of microbe, Pyro (and I may be wrong) was probably meant something more along the lines of your 72 generations multiplied by X number of strains or something.. Anyway, why argue with a microbiologist, that is splitting hairs, the point is what matters.

    I think everyone should go roll around in a cold mud puddle every day. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] All I can say about you people that don't shower every day is Phew! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] just kiddin... [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  5. #29
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    J,

    You are correct, brain going faster than the fingers can type. Millions of offspring is what I was shooting for but replicant works just fine too.

    The point I was trying to make is that if you are given just a single bacterial then given the random mutation of the genome and the total number of bacteria present at the end of the day from that one bacteria then there is a 1 in 4 chance of a mutation that will render resistance. And no one ever gets infected with just one bacteria.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •