User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Pretty flowers

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My wife shot these the other day at ABG. I thought they were impresive so I figured I'd share.





    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    any chance you know what the top one is? the flower shape looks quite damiliar but its Friday morning and my brains not fuctioning. very cool flower and i think Darla would love it simply cause its a dark purple.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  3. #3

    Join Date
    Sep 2004
    Location
    Zone 9
    Posts
    455
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]the flower shape looks quite damiliar but its Friday morning and my brains not fuctioning.
    Ah, that explains it!
    the cellist

  4. #4
    Somewhat Unstable superimposedhope's Avatar
    Join Date
    Feb 2004
    Location
    Where the Slime Live; Where the Slime Breed
    Posts
    1,697
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)


    I was thinkin the same thing
    Joe
    \"There is nothing here of interest to any nation, as a matter of fact there is nothing here but humans!\"

  5. #5
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol see, and yah expect me to remember the name of an orchid genus?
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  6. #6
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol @ Peter.

    Boy they are stunning! The lip ridge on that top one reminds me of a cephalotus. The middle one is a phrag...they are one of my top favorites along with the paphs.

    Thanks for sharing.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #7

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    dude those are awesome
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,378
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice pictures!
    Exceptional camera-work.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •