User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Post Office

  1. #1
    Guest
    I just recieved a couple of Sarracenia seedlings in the mail. They were sent with a "Fragile" sticker on them so apparently some sadistic person at the Post Office decided to kick the box around and sit on it. My little plants ended up getting turned around in their pots and being "buried alive". Most of the leaves are crumpled or broken. My question is.. is there anything I can do to help them out? Any special tips? I rinsed them off and potted them back up but they look so pitiful..

  2. #2

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Uh... Try to give them Ideal sarr conditions... Give them high humidity (if you have fungicide, it might help to give them a light prevenative spray)... Stick the pot in a clear plastic bag with bright, non heating (yeah... try your best... [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]) light... Keep them in a tray of water, and have the bottom of the bag with a thin layer of water to make humidity happen and stuff...

    That might be helpful... I'm supposing.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I suggest potting up in LF sphag as it seems that smaller Sarrs like it better. It also has anti-fungal properties to it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Guest
    Ok.. this brings up a question thats been haunting me for months. I just didn't want to ask because it sounds stupid.. but does it matter what kind of sphagnum you use for CPs? Because I was told that the sphagnum species I use and have access to is alot different than what most people use..

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sphag is sphag and that is all that is important. The live sphag that I have been using is a low growing tight form from SC and it works just as well as the long ropey kind I have my Heliamphora in.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Wink

    You may want to try some superthrive to help alleviate the shock/stress damage.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    Just a thought....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    Guest
    I don't have any. Is it worth ordering? Does it make enough of a difference?

Similar Threads

  1. More bad ideas from our pals at the post office...
    By swords in forum General Discussions
    Replies: 14
    Last Post: 02-09-2009, 01:24 AM
  2. Nep for the office
    By thbjr in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 29
    Last Post: 02-01-2008, 03:46 PM
  3. My post office is annoying
    By NeciFiX in forum General Discussions
    Replies: 9
    Last Post: 08-18-2007, 04:38 PM
  4. Idiotic post office.............
    By rattler in forum General Discussions
    Replies: 2
    Last Post: 10-27-2005, 11:45 AM
  5. Post Office
    By in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 5
    Last Post: 07-30-2002, 10:02 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •