User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 5 12345 LastLast
Results 1 to 8 of 34

Thread: Ppl who grew/grow Darlingtonia post here

  1. #1
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was wondering , how many ppl grew/grow Darlingtonia californica and also the cariety othello which i'm looking for . for ppl whpo grew this plant pelase tell us your experiance or how u think it died cuz and ppl who grew this plant succesfully please post tips and how big it is now .




  2. #2

    Join Date
    Jul 2002
    Location
    Findlay, OH
    Posts
    1,181
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I currently grow Darlingtonia. I keep them in my basement which has stayed below 70F. I water the plants from above daily with cool water. They receive 14 hours of artificial lighting. I will be transplanting them into larger containers soon, as they have outgrown thier current containers.
    Nick

    Careful where you crawl, it might be a trap!

    http://www.carnivorium.com
    http://www.buckeyecarnivores.com

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have 2 Darlings. One is a newbie to me but it is along side my other plant that I have had for 2 years. I grow them in an open mix, perlite:LFS in a 2:1 for the older plant LFS:clay pellets:coco fiber 1:2:1 for the new plant. They are in 7" clay pots in deep trays out on my patio year round in semi-shade all day. 1-4 time a day (depends on the day and how much time I have) I suck water from the tray with a turkey baster and squirt it around the plant. Personally I think that it is water flowing over the roots more than 'cold roots' that makes a difference but I am sure the clay pots help with evaporation a little.

    As far as 'Othello' goes, I am pretty sure this is still pretty rare in cultivation as it is only known from one protected population in the wild and Barry is the only one who knows the location and has collected seed
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    I have a Darlingtonia that I bought at lowes. I have it growing under my flourescents (14 or 15 hours.... can't remember off the top of my head). The temp is usually between 80 and 85 degrees. I top water when the top of the soil looks a little dry. I'm not sure if I'm doing it right, or my Darlingtonia is adaptable. [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have grown Darlingtonia for many years. I grow them in an outside artificial bog 3ft x 6ft x 2ft deep filled with 100% milled canadian spagnum peat. Of course, I am cheating because I live in northwestern California in the same climate that they are native. I have also grown them in a coldframe greenhouse, but they do much better outdoors. Summers here are cool and foggy and it seldom freezes in winter.

  6. #6

    Join Date
    Mar 2002
    Location
    Columbus, OH
    Posts
    248
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi!

    My setup is low-maintenance.

    I've got a Lowe's $3 special ("SEE the amazing half-dead plant! WATCH us callously kill it with neglect! BUY it out of sheer despair!") going in a pot 1:1:1 LFSeaterlite, in an undrained glazed 8" pot. I keep enough water in it to hear bubbling, as I am aerating the soil 24/7 with a small aquarium air pump--the tube runs to the bottom of the pot. The idea is to keep the oxygen content of the soil high, and to cool gently through forced evaporation.

    The pot is topped off with an inch of perlite to protect the soil surface from solar heat. This is ugly, but effective.

    Indirect sun all day, direct late day sun for about 2 hours--this is lengthening with the day. Misted at night, and in the morning, when I remember. Mostly, I ignore it.

    Original leaves grew some to little, and I lost the hood of one, probably to dryness. It has two new leaves after about 8 weeks in the ground. First leaf is quite small, but well-formed. Second leaf seems to be much more ambitious. The plant is a nice, dark green and seems to be picking up steam after a long adjustment period. No feeding or fertilization.

    Steve
    I'd rather have a butterwort in front of me than a...wait, ummm...I'll come up with something...

  7. #7
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here's a photo of my flowering Darlingtonia californica. No big setup...just cold water and the tray system and lots of light. Grows along with my Sarracenia fine.

    [img]http://home.**********.com/nepenthesgracilis/dar1.JPG[/img]

  8. #8

    Join Date
    Aug 2002
    Posts
    887
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    nice pic Dustin [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] , i have one Darlingtonia, its produced alot of runners and flowered 1 time since i got it.(I got it 3 years ago at a shop in Ferndale California, they were called big foot collections...)I grow it in a 1:1:1 ratio of peat moss, perlite and sand, loves the mix, i give it a little overhead watering every other day, if im gone for a long time, simply poke a very, i mean very tiny hole in the top of an empty pop bottle filled with distilled water, and it drips every 5 seconds, i dont put it near the crown, but around 2-3 centimeters away from the growth point. I also grow some live terrarium moss with it. I grow it with my sarras, and it loves it, took a bad winter storm last september, but its recovering excellant! I am planning on getting alot more (4-7 plants) this coming May.
    Kevin
    Kevin Peterson
    Grosse Pointe, MI

Page 1 of 5 12345 LastLast

Similar Threads

  1. My first post! Need help/recommendations with grow rack lighting
    By SeaQuestDSV in forum Greenhouses, Terrariums and Bog Gardens
    Replies: 13
    Last Post: 08-29-2011, 01:06 PM
  2. How do you grow darlingtonia?
    By sarracenia21 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 13
    Last Post: 07-30-2010, 05:11 PM
  3. Book about a guy who grew everything..
    By Sig in forum General Discussions
    Replies: 8
    Last Post: 04-15-2010, 02:36 PM
  4. What's the hottest temperature you ever grew...
    By Cindy in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 17
    Last Post: 05-25-2005, 06:17 PM
  5. Nep seeds Grew!!!!!!!!!!!&
    By carnivorkid in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 25
    Last Post: 05-28-2004, 04:27 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •